Description :
From Genome Similarity Track
Location :
Scaffold_836:4932- 6271
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_836-snap-gene-0.3Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_836-fgenesh-gene-0.1Microtubule-associated protein EB1

Sequence
1339 bases(100 bases per row)
CAGTCGGCGTTCCGCGGCTTCCACGTGCGGCGCAAATTCCAGAACGCACTGGACATGGCCCACCGCATGACGCGTCACGTGGACGAAGACGAATTCGACG
AAGTGAATCTGGACGACTGGATTAGTGCACCACCCGAGCTGGACGACGACTGGGAGAAGCCCACCATGCCAAGACGTGGGGTCGTCCAGGGCAGGGAAGA
GGAACCGGTCGTCCCGAGCGATGACGAACAGGGCGAAGAGGAAGAGAACAATGAGGAGGACGAGGAGGAAGAGGATGAGGAGATCGTACGGCAGGAGGTT
GTGGTCCATGTCTCTCAACAGATCGGCCGACCAGTCCAAGCTGTACCATCCGTAGAAGCAGGAACGCAGCAGAACTTGGCTGCCGTGCTGTGGAACAAAA
TGCGCAAGCGCACTCAGAGGCAAAAGCTCGCGGCCGACGAACGCCAGCGTCAGCAGGACCCTGTGTACCGTGTGCAGAAACTGCTGGGCAAGGCTGCACC
GACTTCTCGTGGTATTCACAATACTAGCACCAACCAGCACGAGTCCACCGTGGTCTCGACGTCCATTACGTGGGGGATCAATCTGGACAAGACAAAGACC
CCCAAGGTCAAACTGCCGTCGCTCGTCGAGCGGCTCCGTAAACGAACCGCAGCGGCCAGGTGAACACCGCGATAAAGTTTCATATCGATTGGTAGTTTAG
TCGTGGCGTTTCGCGAGCCTCATCGACTCTTTGGTCTGCTTCATCATGACCACGAACACGTCAAAGTCGGCCGTGGCCACGAGGATCTCGGAGCACAAGA
CCAAGCTCGACTCGCGGTCGCGATCGTTCGCCTCCCGCACGTGGTGGTAGAACTGTTGCGCGGTCGCGCCCTGCGACTCGAGGAATTCTGACCAACAAAA
AAGAAGCAGTCGTGAGTCGTCTTACTTCCCCAAGGTGGCGGACTCGGATTGTTTCGGATACCTTCGATCTTGCTCTCAAAGAGCTCCTGGAACTGGTTGT
ACAGCTCCGTGTACCTAAAGAGGCCCCACAGACAAGACATGAGTCAGCACCAGGCGACCTGAACAGAGAGTTCGGAGACGCTCGTGACTCACTCGAGCTT
CATTTCGTCACTGTCGGGATCAAAGACGGCGCAGTTCTCTTCGGCAAACCGCTCAAACGTGTGCGCGAACGCGTCGTCGTCAAAGAAGAAGGATATCACT
TTCTTGATCAGCGCGCTGCCGTCGTCGTCGTGGTCGTTCTGCTTGCCTTCATTTCGAAGGCGTCGAGTGCCCTTGGCGTCGCTGTCCTCATCACGGCTGC
CGTGGCTGTATTTGCTCTCGCTGCGAAGCATTCGTCCCG