Description :
From Genome Similarity Track
Location :
Scaffold_313:49319- 53147
Sequence
3828 bases(100 bases per row)
GACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGGAAAC
ATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCCGATGTCCACCTTCTAAACTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCAT
CACCAATCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGATCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATA
ATACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATATTTCCTTAGTCTCACGACCCACGCTTCTTCGTTCTGTGCTTTGA
GGATCCGCTCAATGCGGACTCCCTTCACAAATGTTTCATCGAGAATTGGGGGGGGGCTGGGTCCAATCCTTCCTGTAGACCTAGTGACAGCCATTACCTG
GACTGTCCTTTTTTCGGATCCAGCCACCACCACCTCATCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGACCTCTTTCTCCACTTCGACACCACAT
TGATTCCGTAAAGCGGCACTGGCGAAGCTATCTGCACTGGCATTCCAATCTCGCTTGGCGTGCACCAACTCGTGAATCATCCATCCACGCAGGTGGACCA
TCACCTTTTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCACAAATCACCAGCCT
TTTCGGATCCCGTCCCTTTAGTAGATCCAATCCCAGCAGGAGTCCATTATACTCTGCTTCATTGACGGTAAGGCCCTCCGCATAAGTGGATCTGGCCCGT
ACAACTTTCCATCCGGGCAGTCCCCACAGTATTGCACTGTATGCTCCTCCGCCCCGTCGTACGCGAGCCGATTCATCAAAACTCAGGACGTACAGATCCT
CATACACTTGTACCGTCGAGATCGGGATCCGAATCCGGCGTTTGGGTTCTTTCTTTGGAGCGATCCTAGCCAGCGCCTCATCCATCTTAGCTCGAGGTGT
GATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAA
CGTCCATGTAACCCGGCCGACTTGAGCAGCCAGGCTAGTGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATTCA
ACACGCGCAGAAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTAAGTTCATTCGGCTTTAGTGTCCGGCTCACGAAGGTGACTGGATGACAGATCCC
TTCATGCTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGCCAGGTGTG
GTCGCGATCCTGTTCCTCGGCTCCACGAATGCGGGTTGAGCTCGGATCCACCGAGGTTCCGCCTTTTCCGAGCTCTGATCCGTCGTCTCTATCCTGATTG
GATCCTCTTTCTTTTGGTCGCGGGGCGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTGAATCCGACATCTCCAG
GGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATATAGTACCGCAGCAAACAGTGCGTAA
TCCTCGATGAACCGACTGTAGTAATTCAAACTGCCCAAGAAGGATTGCATCGCCCATAACGACTGTGGGAAGGACAAGTCGGCTAACGAAGACAGGTCCT
TAGGATTCGCCTGCAATCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACTTTGCGCATCCCCCAATAGCTCTTCACCACACTGATAGAGAGATTCCA
CTTAGTACACGCCTCCAGTAGAGATGGCACTCTTTCGCACAGCTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATATAAGATCTGCGTCCTAAC
ACAGACGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTGTGATCTTCCCCGGATCCACCCTTTTCGGGTTCCGGTATTCGGG
TGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGT
GATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCTCTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCT
TCCAACAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGGCCGTTAACTAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCT
TGATGATGATTACCACCGGAGATGCCCACGGGGATGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCTGATAGCTTTTCTCGGAA
CTGAGGTGCCACCTTCCGCACCTTTTGAGCGATCGGTTTCGCGTCGCTGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAATGCATTACCT
TTACCAATCAGCAGATGTCGGCTTTCCCAGATTTTCTGACGTAACCGATCCACTTCCGCGGGCTCGTTCGCCCCTGGATCCACTTGGATATCGTCAATCG
TGACCTCCTCTGCGGTCAGTGGTACCTCCGGGATTACCGCCAGGCCATCCCCGAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACCTGCTC
ATCTTCCGTCTCCATCGGATCCACCATTGGATCCAAACACCGCGACCCTCTTTCACCTGGCAGTCCTTCTGTCTTCGTGGGATCGGGTACCCTGGTATCG
GGGAAGCCACCAGTTGGATCGAGTTGATCCTCCAGCGAGTTTAAACCCGACGGCTCTGGTTTGACTAGTGTTGACACTCTCGATAAGGATCCAGGCACTT
TGCCCCATGAAAAGCTAGGATCCACTCTGGGATCAGCGGGATCTGGCGGTCCGGCTTCAGCCTTCTGCGATCCTTCATCCACCGACCCTGCGTTATCTAA
GGGCCGACTCTGGGGATCATTCCCGGTCTTGGATCCAACCTCCATCGCTTGGACCTCAATCCGACGATACCTCTGCAGGATCTTTCGCGGAGTTGGATAT
GAAGGCCGATCAACCAAGGGGCCAGTTGGCCCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATT
CTCTGTAACGCCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTATGATCTCTTTATAATGGTCCAGTAATAG
TCTCTTGTCGCTGACGTTCGTGACCTGAAGGTATTGCGATCGACCTGGTCCCTGGATTACGGTAGGCACTCATTTCGCGCCCCGAGTGACCCACCGTTTC
TCATGTTCCACCCACTTCAACCGATCTGACAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTAGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCGT
ACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCCTGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGTACCATGAAATC
CATCCCGAGGATGGCGATATTAAACCCT