Description :
From Genome Similarity Track
Location :
Scaffold_23:49314- 57888
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_23-abinit-gene-0.112Tetratricopeptide repeat protein
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.40Histone-lysine N-methyltransferase
Pytap_DAOMBR444maker-pag1_scaffold_23-fgenesh-gene-0.25Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.41Gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.42Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.65Oxidation resistance protein (ISS)

Sequence
8574 bases(100 bases per row)
GCGCTTCAaGTCGcGGGCTGGGAGACAGaGAaGGAAaGtGTcGAaGaTCTGTGCAAGGCTGCGGTGCGtCTTTCGCAGGACTACATGGCCGACAGCACGA
aGAAGTCGCTGTATGCCTGCCGTCTATACATCCGAGGTGTGCTTAAGAaGGCGCAGCTGGACTTCGGTGAGCTGGAGGCCGTGCAGCAGCTTGCACAGAT
GCTGGAGGAGGTCGAGGCGATGGAGAAGGCGCTGTAAGGAGCCAAGATAGATAATGTACTTCGAAGTAGAGAGAGATACCTGATGACGTCGCCATTGCGG
ATCTGAGACCGTACGGTGGAGGAATGACACGCATCAACCTTGTACCAAAACAAGGTATATTCGGAGCTAATTCGCCTTTTATTGAACGGGGACTCGTCTC
TCCCTTTGCTGGATATATCACGAGAGCACCTTGTTTTCGTACAGCTACAAGCTCTACCAAATGGGACTCGGTCAAAACCCCTCCAACTATCGTTTtCAAC
CAATCATGATCCGTGATTTGAATTTTCATCCAATCCCAGCTCCGTATTTGCgCGGGAATGGGAGCTGGCGAGTCCTCTTTGAACTCGCACCGTGGTGGGT
GGACGCAATCACCAACTCTCGCTACGGCGTCATGGTCGCGACGCGCGCCGCCAAGGaCAaGCGCAAGGCGcGGCCCGCAGAGCGCCGTATCAGCTCTCGC
ATCAAGGAGGGAGCCACGCCGGCCACGGTGGCCGCAGTCGCCGCCTTCTCGGCGCGTCGTGGACGCAAGAGCGACGGCGCAATGGCAAGTGCCGAGGCCA
CGACGTCGTCCGATCCCGACGCGTCCGTTGTTGAGGCACCGAGCGAACTCACAGACGCGGACGTCGAAGCAACGCTGCGCCACGTTGATGCGCTTGAACC
GGAGGTGCGGGCGATGTTGGTGGCTCTGCGGAAGCAGGCGCTGCAGCCGCGTCTGTTCGAGCTCCCATTCACACCCGATGAGGCCAAGAGTATCGCGGTA
TGTGGACTCGCGTCTCTCTCGTGGACCCACACGACTAACGCTCTTGCTGCCACTGCTTGACTAGCACCGGAAATTCACGCGGCATCCACCGCCCTATGGA
CGCATCTCCAAGTCGATTGAGGTCTCGGCGATGCTGCCGACTGCGAGTCTGCCCGTGCACAAATGCAACTGCTTCGAAGATAAGAAGACCAGCTCGACAa
CGCGGCGAGGAGCGCAGCCTGCGGCGGTCACAGCGACGGCGCCTGTTGAACCCCGcAAGAAGCGCGGCCCAAAGCCCAAGCCGAAAGAGCCTGTGGTGTC
AACGCCTCAGGAGCTCTACTGTGGGgAGAGCTGCCACAATCGCATGCTATTTATCAGCTGCTCAGCGAATACGTGCTCCGCTCCAGACCCTGCATTGTGT
ACGAACCGTGCTATCAAGCGCCGTGAGACCAAGTGCGTCTTCTTGTCAGTtGATAAACGCCCCACACTGAGATACTGACGGACTCGTTTGTACTAGGCCA
GTGCGTGTAGAGTATGTCGAAGGCCCTGGCTTCGGTCTGTTTGCAGAGGAGACGATCGAACCAGGCGACTTCATCATCGAGTACGTCGGCGAACTGATCG
ACGACAAGGAGTGTGAGCGCCGTCTCATCAAGTATCGCGACGAAGGCGAGGCCCATTTTTACATGCTGGAAATCGAAAAAGACGTGGTCATCGATGCGCG
CTACCGCAGTAACGAAGCGCGTTTCATTAACCACAGCTGTGACTCGAACGCGATGACGCAGAAGTGGAACGTCGACGGGATCCAACGGATTGGCATCTTC
GCACGGCGTCGGATCATGGCCGGAGATGAGATTACCATGGACTACAACTTCAGCCATTtCGGCGACCCCATCGACTGCAAATGTGGCTCCGTGGCGTGCA
CGGGCAAGCtCGGTTtCAAaCGCTCAGATCAACAGATGAAAaTGGGGCTCATGACCAAAGCCAATGCCTCcAAGAaGAGCCTCGAGCTCATTGTCGACAG
CGCGCCATTACCAGAGATCAAacGCCCTGTGCTATTGtCTTCGCTGGCGTTGCTTAAGAGCGCAAAGCTCGATCTGGAATTGCTGCACTACTACGGCTTC
CGCAAACGCCGACtCTTTGTGGGCCAGACCAAGCCCGTAGTGAGAAAGAAGGGCAAGCGGCTAGATGAGCCAGAAGAGGACCCAGCTCAGACGCCCTCGA
CTGCATCTGGAGGCAGTAGCCCCCTTTCCTCACTCTCGACGGTGTCGGCGTCTTCATCTGGCTGCTCATCGCCCTCCAATCAGAACGACGAGaCGAAGCC
ACGACGAGGTGCATGGTACGAGAAGTTTCAGCGTGGGGAGCATCTCGCGGAGATGCGTGGTCTACACACGTATCTGTGCGgCGGGAAGCACGACTGGACC
GACGACATGCGCGACGTTGCGAAGCGGAGCCCATCTACTGCCAAGAGCACTCGTGCTCTGGTCTCCAGACGGGTCACACTGCTAGAGGCCAGAGCTCGGT
TCTTCGCCAATCTCATTGCATTCGCCAACGGCACGTCCAAATGGAACGGCAGAGTTCCGTTgtCCTCGACCATGGACCCCGATCGAATCTATCGCTTCGT
CGATGCCATGAAGAGTGGGAAACAATTTCTCAACCAGAATGCGGTACGTACATCTCTCGTGTGTGCAGTGTACGGTCTCCTAACAGTGCCTACTGGGACA
GAATGACCTGAACGAAGACGCGTGTCATCGCTGCGGCCTCGCTGGCGAGCTCATCTGCTGTGACGGCTGCCCTGCGGCGTTCCATCTCAAGTAAGTTTCT
TCCGAATTATTGTGTGAAGGCTGGAGCTGCCTACTAACTTCTATCTTCTGtAAGTTGCaCCAACCTTGTTATCATCCCGCCGGAGGGTGAGCCATGGTTC
TGCGTCGAGTGTAAGCGTGGAGCACGCCAGCGGTCGCAGACTGAGAGTACGATGGAAGGCCGCAGCCTTCGAGGCCATGCCCACGCAACGACAGCGCCTA
TAGTGCCAAGTCTGAAaCGTATTTTCCACGCGACATCGACCAAGGAACTCACGGGTAAACGCCGTGGGCGCAAGAAGATGAAGATCGACAAGTCGTACCG
CCTGCTGGAGCAGGGTCCGTTGCCAACTTGGGGCgAATCGGATGACGAGTAACCACCTCCTGTAGATATGCTGCCATCTCTCGCTAGTTGACCGTaTAAA
AATGCTTTGAAGAATGTTACTCGTTGTCtcTTTACCCCATATGCATCGCTACTGCTCGTAGATCCGTGCTGGCACAGGgCCTTCGACCTTGtCCTTAAGG
AATGCCTCGCTGTCTtCCTTTGCACGCTGCATAACACACATACATACACCATTTCCAGCATGAGCATGATCATCTTCTCGTTAGAAGACCGCATCCTCGC
ACCTTGAGAGCTGTCACGAGCTGTGCGTACGAACCAGAGTTCTTGAGGGTAGGCATCGCTACGCCGCCATCCAGCTTGCCCAGGAaCgAGTGgTtCTGTC
GCTCTTCCAGAGGCACGCTCTCGTACTCGTTCGACGCTTCCTGCGCTGACGGGAAGCTCTCGAACGCGTGCACACGCTCGCCCTTGAAGCGGTACTCAGC
GCGCAGGCCGGCACTCGTCGCGTCCGCCATGCTGCTGCTCTTCTTGACTGgCCGATAATGGGGAgCCCATTAGCCCCTTACcTTATTGGAACTAGCCTGG
TTTTACCCcTAACACCGTATTAAACACGACATGCCATTGCAATGAAACGAAGCCAGCCTAGCCTAATGCGTGGCTGCAACACGGTCAAGGCGAAGCCAGC
CTAATGACGATTTTCGATCAGCCAGATGGCCGGAATCGCGAAACcGCGAGAGCTGGTGCATGGCGCGCGCCGGCACGGCCAAGGGCGAGAGTATGCTGGA
CGTGGCGCGCGTGCTGGCCATGTCGCGGACATCCGGCTCTgCcTCCGTTTCTGGTGTGCAGTCGCCGTCGCCGTCGTCGGCGTCGGTGTCCACGGCCGCG
GCCAGTAGCGCATTGCTTGCACCAGACTGTCTTAGTGGGCTCCTCGCAGTGCTGCGCATGCTCAAGATCGTGgAGCGCAGCACTGGACTCTGTTTGTTCA
CAACGCAGTGGAAATGGCACCCACACGCGCACGCCGAGGGTGTAGATGCGCTCGTGCAGTCGTTCGCGCAGTTTGCTCGAGAGATCGACGGAGGTGGTGC
GTGGTCCTCGCAGGCGTCGTGAACGAGAGGGCGATGTCTCAAGGCCGTTGATGTGGCAGATATCGTACGCATTCAGTTCGACTCGCGTACGTCCAACCGC
AGTACGAGTAATAGCGTCGGTTCTTCCATGAACGCGAGTGTCCCCATTACGCCCACGCAACTCCAGTCGATCGACGACGACCGACGAGTGAGTTCATTGA
GTGAGGTACGGTATTGATGCGGAGAAGAACGTGGGTCATGGGCGACTAACTTCCGAACTAAGGTCAATGGCACTTCTGCGCTCGAGATGCAATCACaCCA
AAGTGAGCATGTGCAAGTGGTGCTCTTCCACGACCGAGTCTCTGAGGCCACAACGCAGAGACTACGGGCGTTCATCGAGCAGGTTCATACCAAGTTCTTG
CTGTTATATGAGGATGAAGTAGCCCAGCTCCAGCCAACGCTAGCAAGTACCCATGTGAGCGGCCTGACCCCAGAACAGGTAAGCTGCATAGTGCACTTCA
TTGTGGAGTGTGGCCCACTGACACTCCTATCCACAGACAGCAGACCTAGCTGCTCCATTCTCAATCTTCAGCGATGTGCTACAGAATGAGCTACTTCCTA
GCTTGTGATTGGGTCTTTTtGGTTTGATAAAGCGCGGCTTCTGTATTCGCGCCACTTATATAAAACGTGTGTTAATCGGGGACGGCAACTACTACTTACT
TGGTATCCGCGCTGTTGAGTATCGGCGAGGTCAAATTGACGGGCATACATCACATACTTGATCTTTAGTCCAGAACGCTACGCTTTTTCGCCTCTCGATT
TACGACTGGGTTCTTGTCACTAGTTGTGAAGCCCCAGACCTCGACGTATACGCAGTTGAACTCGTGTGACGGAACAAGAGGCCGAGAGCTAAACGTCTCA
CAAGGACCTGTCGTCCCACGAGAGAGGTCCGCGTCCTAATCAGCATACACGATGAGAATTAGAATAGGAACATCCACAGAACAATAATGTGTGCGTACCA
AGTACAAGCCGAAATTGCCGCCTCCTCCCATCACGAGGGATTCCTCCGAGCATAGCATGAAATAGTTGTTTCGACGACTCCAAGGATATTTGGTAAAATG
AGCCCCGGCAGAGGGGGTCGTCGGTGGAGGTGCTCCTGCCCGTGGACTAAaGGTGAAGAGAAACGTCTCGCCGTTGCCAAAGTACTGGGTGGAGCGATGC
CACTCGTCCGAGCCGTAGCCACCAAACACGTTGCCTTGGTCATCTTTGATTACTATCAGTGTCGGGTTGTGGTTCTTGGCCAGCATCAATAATGTGTGTA
GTGATGATCCGTGCGTTTCTGTGCTATACAATAAACACCACCTGCAAAGTTGGCATGTAATTGGCACCGAGTGATCGATGTATGCAACATGCTCAGCAGT
GAGAATATGTGACGGCGCCAGTAACTTGTTTTTGTAGTCCTCTGGCTTGAATGTGAAGGATGGTTTCTTGCTCAATCGAGGGGGCGATGGTGGAGCAGTA
ACAGGGGTTTGACCACCACGCACGGCTGCATTACACATCTCCTCCTCGGTGGACTCATCTTCATCATCATGCATTTGGCGCCACATCTCTTCCCACTCGC
CACGCAAGTCTTCAACACAGCTGGGTGAGTTTTTAAGAAGCTCGTCGACTTTAGCCTCTGTATCACAAAACACCCTCGTGAACGATGCCTCATCTGGACT
GAGCGAATTCCAAATTTGGTCGAATATCTGAAACATGATCAGGAACAGTTTCAAAAAGTAGGACTCTTCATCGAACAGCTCCCAGAACGGTTCGACAGAC
AaCGCCACAATGTTTATGTTCGGATGTTCTGGGGCAGGTCTAAGAAAGAAAAaGCAACATGAATCAGTCAGAACCGGATAGCAAAATGGGCCACAAAACT
TACACAAGATGAAGGAGGTTGATGAGAGACTTGCATATCGCAGAGGCGACTAAACCAGCATCATACGAGCTCTGGACGGTTGGAAGTGCTCGGTTGTATA
GACGATCGAGTAGCGCGGTATCGTTCTTGACCATGTAAGCCACGCACCGTAGAAGCAGCACGCCACCCTTGTCAAAGTTCCCTAGAATTGTTGGTCGATT
GAATCCGTGCTTTTGCCAGGAATCCGCAATCCTCCTGTCAATCTCTTCTGCAATATTGTTAGGAGGAGCTATTCCCACTGTCTGCCTTCGACTTCCCAGA
CTGCCCCCGcTTCCTGTCCTTGAGCCCGAATAGCAAGTATTTGAGAATGTCGGTAATGGAGGAATCGACGAAGGGgCTGACGAGCTCAGCATCCCTTCGT
AGAGCATAGGAGACGAGGCACGATGCTTCAGAGGAGACGTTACTTTTCGGACAACCGGCGGAGGGATGCGCTCTGGATTATTTGGAGGTGAGTCGCATGT
TGGAGATGCTTCCTTCTTTTtGACACTTTCCATGAAGATATCTGATATCTCGTCAAGATATTGACGATCTGACAAGAAATTGACTTGAGGTCTCATTTTG
TACAATTGGTAAATCGACAaCAAAGCCTCCTTCTTCGATTCCAAACGTTCTAGTGCATCAGACACGTGGAGACGCACATCTTGGAAAATCACATCATAGT
GTTGGATCATCCTCTCTACAACTTGAGCACCAACCGCAGCAAAACGGACGTCATGATTCTGAGTATGAGACATCTTTCGTTGTCCTGCAGGTGTGGTGGT
AGCTTCACTCTTGAATGCAATGACTGGAGCTAGCATAGTCGAAGCTACAGTAACGTCCACCCCGTTCTGCTGTGCATGCTCCGGCAACTGTAAATAATGC
ATGATGCCGATTAACTTCTCCAGAACATACTTGCAATGAGGAGGAAGCTCTTGCACCAAGCAAGCGATATTGCGAATGCTCGCGTCTTCGTCTTTTATTC
TTCCTGATGCAACAAACGCATCATATTTCTCAGATGTAAGGAGAGATTCTGGGAGATTCTTGAAGAAATCAAGCAAAAGAGCGCCGGCCCCATGGCCATC
CAAGTCTCCAGGAGGTGCGCCTTCAGTCTCAACAACTTCTCGCAGCTGGCTGACTGTAACATTCAGAACTGTTGTCCGGAAGAGCCGTGGAGTGTTTGCA
TGCTCGTACAAAACGTCGATACAATCTTGAACAATATTTGGGATGGAAAGGACTGGGTCGATCAAAGCAAACCTACTATGGTATGGATTCTTGGACAAAT
ACGCAAGACTGACGCCAAAAACATGTTGCCATGGCTTGATGCCTTTGTGTCGATGCGGAAAGTAAACAGCCGAAACTTCGACGAAATCGTCTGCAGGTAA
TATCGGACTAGCCTCGCTTTGGCCAAGTTTATCAGCGGACACAGTTACATCTGATGCTTGAGGTGAAGTTGGGAGGGATGAAGGAGCAAGGGGAGTTGCT
GCAATAGCAACAGCATCGCCATCCATTTTTGCAGTTTCTGTCGGACTTGGGGTGATTGGTATTGCCAGTACTTCCTTGGGTGCTGACGGCTTGAACGACT
CGTCATCAACCTTGATGTTGAAGCGTACGTCACGGCAATCAATGACCATTTGCAGAAATAGGTCGAGACCTTCCGAGCATCGCATCAGTGACCACTCTTC
GTAGCTCGATCGTACGACCTGATCACATGCCATCGAGAATATAATCTGCAACAAAGAACATTGAGAACGAAGTCTTCAAACTCTCACCCGTCAATAATCT
CTCACCATCAGGCTCGTTTCCAAAGTCTGGTTGTTGAGTGCCAGTTTCAGCCAGCATAGACCCTTGCCTTCGTCGGTCTACAGAGTAAAGTCGGATCAGT
CTACATTAATAATAAGTCGTCGTCGGTGAGCTTGATACCTCAGACAGGGTCGCGGCTTTCTGGATCCCGCTTACTAGTGACGGCTCGTCCAGAACAAGTG
AACTCGAATACAACACGTTCCAAAGGGAAATGTCGTGATCGCTCTGGTGCTTCAAGCCAAGCTTCAAGCACGACTCGAGTGCAATACCTTCAGCATTGGA
GCCATTTGGTATGAGCCACTGTTACCTCTAGATTTCTTGTGGTACTTACCCATGTCATGTACGCACGAGTCTTCCTCCGTCAGTATTCGACGAGGCTTCG
TCGGTGTCACTGCAGTTAGCGCCTTTAACGCTGAGCCAGGGGTCACTACCTCCATTTCCCCACTGCTCGTGCGTCCTTCGGACACTTGCATCACGTCCAA
CGTCGCCTTCTTCATTCGAGTCTTCCACATGAACACCACTCTATATGAGTCACGAGACAAAGAGGAGGCAACCAGCCTCTTCCAACTCACCAGTGCGTCA
AAGCGCATGCGCAGATAGTCATCCTCCTTGTCTTCGAGCTTAGTGGAGAGCCACtGTGTGATTCGCCCCAGCAT