Description :
From Genome Similarity Track
Location :
Scaffold_311:4931- 9021
Transcript NameFunction/comments
g10039.t1hypothetical protein

Sequence
4090 bases(100 bases per row)
CGCCGTCGCTTCCGTCATCGTCGTTATCCCCTTTGTCGCTGCCGCCGCTGGCTTGGCCATCCTATCCACGATCACTAGAAGAGTTGACGTTGATCGGCTT
GCTGGGGGTACCCGCTGCGCGACGCTTCGAACGGGACAAATGTGATCATCTACCAGATGAGCGCGAGCGAGCGAGACCGGCGTTCAGAGCGTCGTCATCG
TCGCTGTCGCCGGGTGAAGGAGATCGGCGACGTCGAGACTTGTGGGGCCGATGGGGCCGCTTGCGACGAGAAGACGGACTTGATGGAGAGCGGCGGGAAG
GAGAGCGGCTGGCGAGACGTTTCCGTGATGGAGTCTTTTTCAGCAGAGAGGGATCGCTGGCTGGCGTGGAAACAGGTATCGCCGGAGGAACGATCGAGCC
AGGTTGAAGTATGCTGGTAATGTCCGGAAGGGGCCGCAAAGCACCGTCTCTCTGATCACGCACGCTCTCCAGATCTTGTTGGGATCTACGGGCAGTCGCG
AGGTCGGTACGCAACACGGCATTAGTGCTGCTCAGCTGGTGGTTGGCGGCTACCGAAGACTGGAGGCTGCTCGCTCGTTGCTCCAACCGAGCTATGGAGA
GCCGGGCGGACGTGACTTGGTTACCTGCAAGAAAGAGAACGGGTTTAGATCAAAGGACGCTGAAGGTTTGACACGATTACGTACGTGCTTGCGAAAGCTC
GTTCCGAGCGCGATCACGTTCTTGGGTCACCCGTTGCAGTTTCGTCGCTTGATCGCTTAGATCTTGGTCGGACTTGTCCAGTAGGTCTTGCAGCCGTTGT
CGTTCCTGAAGACTCTGATCGAGGGTGCGTCGGGAACCGTGTCGGGCTTGCGCCAACTGGTCGCGCAATTCGGAGGCGCGACGCTCGAGTAGTGCCACCT
GTTGCCGGAGGATCTGCGCTGATCCCTCGAGAGCTTTCTGAGAGGTCTCGAGATCGCAAATAGAGTCGCAAGCCTGATCCAGATCACGGTTCGCTAGACC
TTGGGCTGCGATCGCCACGTTCAGCTGTGATTGGAGTTGGAGGGGGTTCGGGTTGACCCCAGGCGGAGGTAGAGCGGTGCCGCCAAAAGTCGTGCTGGCG
ACTGCCAATGCGGCCGTTAGACGCCGCTCCAAATCGTCGATTTCCCTGCTTCCGCGTGTACGCGATCCTGGAGACGCATACGATCACGGAGGTTGGTGAG
CTTGGTTGCATTGTCGAGTCTCTGGGCCAGAGCTTCTCGGGTTTCCGCTAAGTCCAGGGTAGACTGCGCGAGACGATGGGACAGCTGACCGTACTTCTGC
TGGACGAGGCAGACGAATGGGGACGGTGATTGAGCCGACCGAATTGTGTGCTCCAGATCCGCCACACGCTGTCGCAAGGCGAAGTAGGACTGCAACAAGT
CGTTGTAGCTGTGCTGGAGTGCCTGAAACGCACTCTCGCGATCCAGAGTGGCCTCGACCTCAGCCAACGACCTCCGGATGGTGGTCTGGTCCAGGGGCGG
CAACGAGGAACCAGCTTGGGGCAACGGTTCGATCGGGAGAGCGCCAGGCTGACCTTCGATTCGCTGGACAGGCCTGGGAGAGGCGGCCGGAACTGTAGCA
GTGGCGTCATGTGCTACCGGAACTGCGATGGACGGGTCCGAGGTCGTAGCCCTCTGCTACGGCGAAGGAGATCGAGAGGGAGCTGACGTGGGCGAATGAG
GAGAAAAATCGCTTGTAGGATCTCTCTCATCCGGCGAGGAGTTGCCTGGCATGGTGCTGTGGAGGTGTGATGGCGAGGAGCGAGAAGGAGAAGTGACGAG
TGTGCACGCCAAGACTGTTGCGCAGCCACGGCGTGTTCAGGGGGCGATTGTGGTGAAGTGGAGGTTGGAAATTTTGTGATGGACCAACGATGGGCTAGGA
TCGGACGGGACCGGACGTACGATCGGAGGTTGATGAAGACCGACTTTGGAGGGATTAGATCGGACCTGAGGGGTAGGGGTATGGAGACCCGATGGGTACA
GAGGCGCCATCAGTCATCGGTGTATACCGGTATGCGGTATGGTGCGATCATTTCGGTATGCGATCGTGGTCCCAACTGCGATCGCGATCCCGATCATAAA
TGACGATCGTGGCATACCACTTTGGCGGTACACCCGCAATCATTCCGGAGTAAGGATTCGCGGAAGGTACCTCGGGAGATGGGTGAAAGAATCCAGTAAG
GGGGGGAGGAGGATAGGAAGCTGGGATGGTTGTTTTGTTTTGCTTAATTTGAGAAGAAGAAGCTTTCCCTTGCAACACAAGTGGCGTTCGTTGATTCCAG
GCTGGGAAGTATATTGGCCCTCCTGACGACTTCGGACTCACCTCGTCGCGCACGGTAATCATACGGGAGCCCTTGGATCACTTGGCCAGGTGCGCAACCA
CTTAACTCCCCCCAGAAGACCCCGCTATAGGAGGCGGCAAGCACGTAAAGGAACACACGCAAGGACACCCCCCACGCCGATCAAGCCCAACCAGGCCCCG
ATCGGCAGATCACCGACGACCGCGTGAAGAATACCCGCGTGGCCGTCACCACCCAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCGTCTTGGTAAC
CACCGACGCCTTCAGTGAACACCGGAAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCGTGCCAGATCAACAGAGTAC
CCCCTCCGATAGTCGGCAGTCCGGGCGTACCGCTGGTAAGCCGGAGATCACGACAGCAATTTTCGTGATCCCGCTTCGCCACATTTGTCTGGATCGTTCC
AACTAGGTAGACATTGCGCCGTAGCAACTGCAGCGCAAGCTGCACTGACGTATAGAAGCGGTCTGTGACGACTGCGTGATGAACCCCCGCTGGCTGTTTG
GGTAAAACTTCGAGAAAGTTGCGTAGCACAGCAGATGGCCCAGAGTTAGGATCGGCTGAAAACTCGGTCGGGGTTAGCTCATCCGAATGCTGATCGGTTC
CGCAGACGATCTCGATCCTGGCATGATGTATATACAGCATTAGCGATAAGAAGCATCAGTACAAACACAACATGTAGAACTCTGCCAAAACAAAATAAAG
GAGACTCCGTCAGGAGTCTCCTCGTCAACGTACCGTAGACAATACGCTGTGTTTGGCACTGCAAGTCATGAACAGCTTGGTTCCCCACCTATGGGGCTTG
TCTTTCATATACTGGCGGGTGATATTGTGGCGGCTTCTTGAAGGAATCATGGCTTCATCAAAATACAGCACTGGTGGTGTCTTGAAACCCTTTCGAAAGG
TTTCCTGCAACGTTTCCACGACGGACCTGACCTTCCATGCCCTGTCTGTCTCCGCACGTGCGTCGGCATTGTTTGTGAAGTGTAGGTTTTGCATGATCCG
ATCAAACCGAGCTTTGCGCACGAAAGCTCCAAAGGTGCCCCTTGGCACAGCCCCCACTCCATGCGTGCTCCAATGGTCGGCAAACTTCTTCTTGTGCGGG
TTCAGCATTTTCGCTACGAGCAAGCCATTGCAATGTATTACATCCTCAGGCTGAATTATCTTGTGGTTCTTCGTCTCTTTCATCATCACGTCATCTCGGG
AAACGTCATCTCCTCTCGCTTGACACGCAGCGACTATTCTGTCCACGCGCGCGTTGAGATTTTGATCATAGTAGCGGTTGCTCTCCGAAGCAATGCGGCG
CCACAGCCGAGGGGGCATGAAGTAGAAGAATAGGCGTAGCGGTGATTCAGCCAGTTCAAGCACTTCGGCGGTTGGTCCATACTCTCCATCGTACAAGCTA
GGATAAGACTCTGCTCGAACCGGTTGTGATGCGGCATCTACAGAATATACATCACGCTTCAGTCCAATGTAGTATATACAACATCAAGACCATCACACAG
GTCTTACCAAAGTTCCACCCATCATTCAGCATTTTCTTCAGCGTTTCGTCATCCAGTGCAAGAACCTCCATCTCTTCCTTGGTTAGGGTATCCCACTTGT
CGGTCGTCTCGCTCCACTCGCGAGAGAGGTTCGCCTTTGCTGTTGCCAGCCGCTTGACACGAAGTGTTCCTGTGTTTTTCTGTGACGCAC