Description :
From Genome Similarity Track
Location :
Scaffold_24:49306- 51203
Transcript NameFunction/comments
g4767.t1hypothetical protein

Sequence
1897 bases(100 bases per row)
TCTCGGACGTGGTGTCCAAGGACCCGCCGTCCCAACTCCCACCTGACCGAGGAGTTAGGCACGAGATTGATCTCGTGCCAGGCACAAAGTACTGTGTGAC
CAGGCAATGGCCACTGCCTCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAGGCAAAGGCAGGCATGGTGCGTGAGTCGAAGTCTCCGCAC
TCGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGCCCGCCCAGACACCCA
TTCCCCGCAAGGATGTGTTGTTGAACAACATGGCGGGCTGCGAGCTTTATAGCGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCTCGAGCG
CGACATCCCGCTCACGGCGGTGAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCACAGGGCCTATCAAATGCCCCAGCGACTTTCAATCGC
TTGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATATCTTCGTCCATAGCCGTGCCGGGGAAGGCAAGACGGCTATCG
AGGTGCATCTCGAGCACCTCCGTCGAGTGTTTATGGTCATGAGAGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGAGATCAA
AGTTCTCGGCTGCTTCGTCAGCAGCGTCGGCGTTCGAGCCGATCCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAGGATCTT
CGCAAGTGGTTGGGTCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATGCCGACT
GGCGCTGGGAGAGCCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGCGCGCGCCGGTCCTGGCTTTGCCGGACGAGACAAAACCGTTCAG
CGTTGTCTGCGACGCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGATGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGCTT
AAAGCCGCCGAGAGGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCCCTTGTCAAGTTCCGGGTACACCTCCTGGGCTCTGAGCCCT
TTGTGATCTATACAGACCACGCGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGAATATAA
CTTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCCCGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTACGACA
GATCTGTACGATCGGATACGGCTAGCGTATCGAGATGATGAGAATCTCTTCCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGCCAAGCATGCATGGC
TAACGCCCCGCCATCGTGCCCGCCTCCATCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGCATGGATCCGGCCGATCCTCCGCGGATAGTCGTCCC
CAACGACGAGGATCTGAAGTATGACATACTTCAGGAGGCGCATGATGTGCCTTCCAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCAGTCTCCCAG
GTCTTCTGGTGGGCCCACATGTACAAGTGGGTCGCCACGTATGTAAGGACCTGCGAGACATGCCAGCGAGTGAAACCTGCTGGTCATGCCTCGGCTCCTT
TGCAGAGCCTGCCAGTCCCGGAAGACTGCTGGAAGTCGATGAGTCTTGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCT