Description :
From Genome Similarity Track
Location :
Scaffold_2989:493- 2662
Sequence
2169 bases(100 bases per row)
CGAGGCCTAAGTCGGGAGGATACCAAATCCTATAGTATTATCGCTACTGATTATGCAGTAGATCTGAATGACTTGCTCTTTTATTGCCCCCTACGAAGAG
AGTCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAGCAGGATGTCCTACATCACTATCACGCTAGTTTAGAAGGTGGACAT
CAGGGAATTGGTCGGACCTATCAACGGATCCGGGAATGTTTCCACTGGAGGGGACTATTCAAGAGAGTGCAACGATATGTCCGGCAATGTGTGGAATTGT
GAGACAGACAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGATTTACCCTTTCCAAATCATAGCCATGGATCACATCCCCTCGT
TGCCCAAGTCGTTCAAAGGAAGCACAGAATTGTTGATCTGGATGGATCTGCTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCACAAAC
CATTGCCGAATCGTACGAGGCGTGCGTTTTTCGAAAATTTGGGGCTAGTGAAATGATTCGGCATGATCGGGAGCCAGGCTTTATGTCTGACTTCTTTCGA
GCCTTCAACCGGATCCTGGGGCAGAGACAGCGGGCAACCATGGCATATCGTCCCCAAGCCAATGGATCGGCCGAGCGCATGGTACAGACGATCACGAGGG
CACTCAAGCTGTATGTTCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCTCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGG
TGACACCCCATTTTACTTGGTACATGGGTGGGATCCTAAATCCACCCTAGAAGCGGCCATTCCGGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGA
CGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGAAGTGCGATACAGGATCGAGCGGATCGACACAACG
AAGACGCCCGTCCCCATCAAATCCAAGTGGGATCGCAGGTGTGGCTATATTTAGATCGGGTGAAGGAAGGGTACGCCCGCAAATTAGCCCATCTATGGTA
CGGACCGTTCCGGGTAAGCGAAAAGATAGGGGAACAATCGGTGAAGTTGGAAACGGCAGGTACTGAATATCGCTTGTTCCCTGTAGTACACGTATCCAAG
CTGAAGTTGTTCAAGGAATATCCGAACCGGCCACAAACCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATA
GTTGGAGTGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAGGGAAGCGAACTAGATACGGACGGATTTACCGCGAATT
TCTGGTGTACTGGAGTGGATATGGCGAACCCAGCTGGGTAGCCGAGACAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGCGGGATCGTACGAAT
CGGAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAAGGGGATCCATGAATGTGAGTTAATCATGTCAATAAGAGGATGAAGAAGGACCCAC
AGGATAGGCGTGGGCCGGGAGGAGGAGGGTCGCTGATGTAAGTTGGTCACATCGGAAAGAAAGAGGAGACGAATCCACAGGAGAAGGGTGGATTAGGAAG
AAGGAGTGAATGTTTATGCATAAGAGTGACGTTTTACGTGTGAGGAGTCCTGCTTGATCTCAAGCACGGACCTTCAAGGGGTCCGAACTGTACTGACCCA
ACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTATACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCC
AGGTGTACACGGAAAGGGTGGATCCAGCCCAGATCCAGGTGTACACTGAAAGGCTCTGACTAGATTTCTCAACCGACGAAGGAATGTTATAGACATATTC
AAGTAAGAGAGTGTGGATTATAATAGCTTATGCAAAAGGCTAGCTCGACCCAGTATCCAGTCGCTAGTTACTGCTACGAAACGAATCCACGAAGACTGAA
ACTGGGGGCGTGGCGTCAAAGAGTGATGAGGATCAGGAAGTCTTGGCCTGAACATTGAATAACTTGCCC