Description :
From Genome Similarity Track
Location :
Scaffold_2017:493- 2271
Sequence
1778 bases(100 bases per row)
TTCCTCTTCTACAATGACCACTATTTCTCCAAGTTTTGCTGATCGTAAGGCTGGAAAATCTTGTCGGCGTTGTGGTTTTCCTTTCGCGTCAATTATGCAT
GCGTTGTCATGTCAGGTAGTGTTTCGTATAAAATCTATTTGAGTGGCTGGAATTTGGTGCTTCGGAATATTGGGGGTTGTGAAACGTAACTTAAGCTTCC
TGGTATCCAGTAGCAAAAGCTGGTGGCAGCCCCGGTTTGCTGGAATTCTTGAGTCTCCGCTTGCTGTTCACCACTTGGAAGAAGTTGTTGTGAATGCGCC
CACCATCATTCAATTTGCCCCAATCCTTGAGCAGTGATAGCTGGCGTTCCATGACTTTCACGCAGACTGGACGTTATCATGGATAGGCTTGTTGGCTGAA
AAGAGCAGCACTATTCGGTCATAGGTATAGCTGGATGTATTGCTGCGtgccacgctgctgcgtaATTGCCCCTTTCTCCTTGTAGCCATCGTTCCGCCAA
ATTTACACGGGTTGCCCTCAGAGCACATTGAATACCCTGGAGACGAAGTCCGCCATAATGACTTGGTGTGAAAAGTAATGCCGGATTAAATTTATGTTTT
GTCGACGCCGTACTGGCCGTGGAATTCCAGATGAACTGCTTTTGAAGGTTTTCCAGCTGGCGTAGAACATCTTTTGGATGTACTAGTTGTTTATCTGTAT
ACAAAATTGATGGCAAAGCAACGACATCGAACAGTGTGATCCGTTGTACCACATAGTTACTGATAGTAGTTGCTATGCGGAGTCTGCGTTGTATTTTTCC
GATCCGTATTTCCCACTTTTCTTTTCACTACTATCATATTGCCCACTCAAGATCCAAGTTGTCGTGTTGTTTCTGCAGGATGGAGAACAGGAAATCCATC
CCATCTGGATGGGGTTGAGTGAGTCTTGAGGCCAATTAATATGGTCTTGTGTGGTTGGACCGTAAGCCCTGATACTTCTCCAAAGGTCCGAAGTATCCGT
TTGACTGTGTCAAGTTCATGTAAAGAGTTCATGAAGATTGTACTATCATCCACGAACGCCGAGAATTTGTGGTGTCCTGTGGGTGCTCCAGGGATAGCAA
TACCTTGGAGCTCCGGGTTTTTATTGATGGCTTGACCAAGAGTGTCCACTGCCAGGATGAAGAGTAATGGTGCTAGTGGACAGCCTTGTCGAATTCCCGA
TTCAACCGACCATTCCGTTGAAAGCTTCCCATTTACCAAGAATTGGGCAGTAGTTCCTTCGTAAAGAGTCCTGATAACATTCAAAAATTGATCCGAGAAT
CCGTACGCTCGTAGTACTCGTTGCAAAAAGGTTCTGTCGAGAGTATCATATGCTTTCCGTAAATCAAGGCAGAGTACCGCTGGGCAGTCAGTCCAAGCTT
TGGTGGCGTCCTCAGCGCTCATATCTAAAATGCTGCGAAGAATAGTTATTGTCTTATCAATACTGCGTCCGCGAACAAATCCTTGCTGTGATGGACTGAT
TAGTTGAGGTAACATTTTGTGGAGTCGTTCAGCAAAGTCCCTCCCAAACAACTTCTATGCAGTGTTTAGTAATGCAATTGGACGATAGTCCATTGCATCT
CCAGAGTCTCAATTTTTTTTTGCACGGGAATGGCTGTCGCTGCTAGAAGAGAATGAGGTACTCCGTTTCCTTGCAAAATACAATGGTCAAACTTGGTGTG
AGTAGGTCTGCAAAGTCTTTGTAGAATTCATGGTTGAGTCCCGTCGTTTCACCAGTCTTGTGTCGTTTTAATTTGTTG