Description :
From Genome Similarity Track
Location :
Scaffold_164:493- 1920
Transcript NameFunction/comments
Phyag_g2932hypothetical protein PHYSODRAFT_566503

Sequence
1427 bases(100 bases per row)
TCCATCGGCGGCATCCAGTCCAACCAGACGCGGCAGGTGGCTGCGGTGGCCGCCCACCTCGGCTTCAAGTGCGTCTTGGTGCAGGAGAACTGGGTCAACT
ACCCGCCTGAGGAAGCAACGGTATACGACAATGTCGGTAACATCGAGCTGTCTCGCATCCTGGGTGCGGACGTGCGCAGGGACGCGGCCGGGTTCGACAT
CGGCATTCGTCCGAGCTGGGAGGCGGCTATGGAGAGCGTCAAGAAAGCTGGCGGCAAACCGTACCCCATCCCGGCAGGCTGCTCGGAGCACCCCAAGGGT
GGCTTGGGTTTTGTTGACTTTGCTGAGGAAGTCCGtcagcaggagaaggagctgggtTTCAAGTTCGACTACATTGTCGTGTGCGCTGTGACGGGCAGCA
CTATGGCCGGTATGGTGGTTGGCTTTGCGGCCGACGGACGCGCCAACAAGGTTATCGGCATCGACGCGTCCGCGACGCCTGATAAGACCCGcgagcaggt
gctgcgcatcgccaagaacacgGCAGACTTGGTGGAGTTGGGACACGAGATTACcgctgaagacgtcgtgctggacaCGCGCTTTGGTGGCCCCGAGTAC
GGCCTGCCCAACCAGGGCACGCTGGACGCTATTCGGCTATGCGCGCGCACCGAAGGCATGCTGACCGACCCGGTGTATGAGGGCAAGTCGATGGACGGCA
TGATCTCCATGGTGCGTAACGGCGAGTTCCCGGAGGGCTCCAAGGTGCTGTATGCTCATCTGGGTGGCGCGCCGGCGCTGAGCGCGTACAGCTACCTCTT
CAAGGAAGGGTAAACAGGTAGAATGCAAGGGCCCACCCGTCCTGTGCATGAGAAGCATGCACACTGGCCGAGTGCTTGGGCTGTAGAACCATTTAGTAAC
GAGAAGGCTTGCACGGGCTGTTCGTGTTGCGTAGAGACTTATAAATTCACGTTTCCAATTGATGACTCACGACTGACGTTATCCATTCGAGAAGTAGTAT
ACTACGTAGGTAGTTTACCCTTGCAGCATACAAGAACAATGACACACGTGCGGTCATGGCCAAACGTGAATGCAAATtgacttcaacatcaagtTGCCTG
TGTGAGGATCGCGATCCGATCAGCTTCGTGATCCGTTCGAGCTCCAGGTTGTTGAACTCGACCTCCGTTTCGGGGGTGCTGATAATAAAACCCAGCAAGG
TGTTGAGCGTCACAGCGTGCTGATCAAAGGATAGTCAACACGAGGGTTGGCCAAGGCTCACAACTATCGACAGCAACTCTGCTCGTCAGCATGGACTCGA
GTCAAGAAAGGCCAGCAAGGAGCGATTGGGCGTGTACCGCTGACGCAGCAAGACGTGTCGGTCGTTGCAGTTGTTTGAGTAAGCCCACCAGCTACCGTTG
AAACGATGCAGCAAGGGTATCAGGTCG