Description :
From Genome Similarity Track
Location :
Scaffold_1635:493- 1808
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1635-snap-gene-0.2Pectin lyase

Sequence
1315 bases(100 bases per row)
GTATGACCATCAGTAACTCGGACTTCGACGGCCGCACCTCGTGGTCGGCGTCGTGCGATGGTCGCCACTACTGGACGTTCATCTTCCACGGCACGCAGAC
GCGCATCAGTATGATCAAGAACTACGTGCACAGCACCTCGGGTCGTTCGCCCAAGTTTGGTGGCTCGACGGACCCCAAGACCGACGTGGTTGCTCACGCG
GTCAACAACTACTGGGCCGACAACTCGGGTTTCTCGTTCGACGTCGCGGAGAAGGCGTTCGTGCTCATGGAAGGCAACTACTTTGAGTCGACGGCCAACC
CGAACTTACAAGACTCGACCACGACTGGCTCCGTGTTTGTACCAACGTCGAGCAACCAAAACTACTGCAAGTTGTACTTGGGTCGTAAGTGTGTTGGAAA
CGTGCTGCAGAACAGTGGCAAGTTGGTGAGCCGTCAAGACAGTGTGGCGATTGCGCGCTTGAAGGGCTTGACTGGCAAATACACGCCAACGGATGCAAAG
AAGTTGGCCATCGTCACGTCGAACTTTGGTGTCGGCGCTTTGAAATAAGTTTCTTTTACTTTCTACTTTGATAGTGAAGTGATCGATGATAAGTGCAGCG
CAGTCTTATGTGCTTCATTCTAACTCGCTTAAAGGCACTGCTAAATACACCATTCCACACTCAATATGGTATTGTGTAGACGTCGCTCCGCTATGAAAGT
ACAACTACATCAAGCTGTGTGTGTGTGTGTCATGGGCATGGCTTACAACGAAATATACGTGCTGCTACATCTTAAAAATGACATTATGTACATGTATGGC
TTAGATGGTCGTAATATGGATCGCCCTCACCCACCCTGTGTGTGAAAAACAGTATAGGATAACGTCGACAGCAAAAGCCCGCGGACTTCTTCGTCAACGA
TAACGGCACCGGCAAGCACACCGACCAAGAGCCTCGCGATCGCAGCACGGATTAGCAGCATGCCTACCGATTGAGTCCTTTTTGTAAAGTGATGAGGCAA
CCAACACAGTGCATCGAATCAGGAGAATGAAAAGGGAAAACTGAGTGAGTCCGCAGCATTACATTGAGAAGAAAAGAGCAAGCTCCATTAGGCAAACACA
GATTCCCATGTGCATTGAGTTGGCCAGGTATATGCAACAGCTCATATAAAGCTGCGAAACAATTTTTGTTGCTGTAGAAAAAATGAGGTCTGTACAGTCA
GTATCGGTGAGCTGAGCTCCTCGCCCTTGACCAGCGTGTTAGAAACTGGGCAGCTCTAAAGCAGCTGTTTGTTTGCGAAAGTTGGTTGCAAAGGGTAAAG
TGCGTCCATCAGTGT