Description :
From Genome Similarity Track
Location :
Scaffold_1003:493- 1554
Transcript NameFunction/comments
Phyta_totarag11711hypothetical protein

Sequence
1061 bases(100 bases per row)
AGAGATGCGACAGCAGTGGCAACGTGGACGCGGGAAGAGTACCCACGCCGGACTCGCGCGGACGTAGCAGCTACTCGGAAGTCTTCGTGTGCTGGCCGCT
TCATgactgcagcggcgtcgtggagCCCCTGAGCGACGATGAGATGCACGCCTGGTTCGAGCGCTGGCGTGGCACACGCGGCAAGACAGACGGTTACGAA
AACTCGCGCCGTGACCAAGCGCTCGCTCGATCAAGCGTGGAAGGCCTTCGTCGAGCGCTGGAACACGGAGTCGGCAGTGAAGTTCTGCCGCATCATCGAG
ACGCGCGAGGCAACGCACGAGCGAATGTCGGCTGGCGTGCTCGCTGCGAAGGTCTGCAAAATGTCGTGGGACTCCGATCGCACGTGCTGTTACGTGCACT
ACCTGGAAGGTTGTCAAGGCTGTCGCGGGTACGGACTCCCGCGACCGTACGAGACAGAATGGGCGCGCTTCATCAGCGACATTTCGCTTTCGGACTCCGA
GGTGACGTGGATCGGCTGGTACCGCAGGGTCTTGTATGAAGCTAGGCGCGGCTCGCTGCCGCACCCGTTGGAAGACCGGTCTCGTACGCCGCCACGCAGT
CCGGAACGTCCGCCATCAGGGACGTTCGAGGCTCTCAGCTGTCCTCCATCGGACCGAGCCACCGCACCAGATACTGACGATGCTCCGGTATACTACCGTC
TCGGTGTAGCCTACCGCGACCCGTACGCCGCCTAGTCGACGGGAGACCGCGAAGatcgtcgtgctgcacaATCGCCTCGGCGATATGGCGGACATTCCCA
GCACTATCCACGAGTGGAGCTGGACCATCGCGCTGGAATTCAGTCTGTGAGCAGGCAGCGTCTTGACGACGTGTTGCGGCGGCTGGAGTTTCTCGAACAG
GAGAACGTGGCGCTGCGtgaacagctgcagcgccagtcgACGACGTACGGGGCGCCGCCGCAGTGGCGTCGGTGGAGCATCGTCACTGGGGATAGTCGCG
GGTCGGTAGCGCCGGAGTCTGCTGACGTGGCAGGTAGGATGGAGACGTAGTGCAGTAGGTA