Description :
From Genome Similarity Track
Location :
Scaffold_120:49292- 50879
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_120-snap-gene-0.27Amino Acid-Polyamine-Organocation (APC) Family

Sequence
1587 bases(100 bases per row)
GGTCACATCTTCCGGACCAAACCACTGCGTGTGATCCGCGCTGAAGAGTACCTGCAGGATCTGCCACGCACGCTCTCGCTCTTTGACTtGGTTTGCATCG
GCGTTGGAGGCACGGTGGGAAGCGGCGTCTTTGCTACTACTGGCGACATCATTTCAGGCGTTGCAGGACCGGCCGCTGTCATCTCTTGGGGGCTCGCAGG
GCTGCTCTGCGCGGTCAATGCCCTCGCGTATATGGAGCTCGTGACGCGCGTGCCTTCCTCCGGATCAACATACGCATACGCGTATCATGCTCTCGGTGAA
CTGCCGGCAGTGATTGCTGCGTGGCTGCTGACTCTCGAGTATGGCATGTCAGGAGCCGGcgTAACTCGCTCCTGGTCCGACAAAaTGGTAGAATGGTTGA
GTGGCGATTACCCGTCgAAGGACTtCCGTTGGCTCAACGCtGAACATACAAACATGCTCGCGGCGCTTCTCATGGCTCTTTGTGTTGGGGTTCTGCTAAT
CGGTGTGCGCTTCGGGACGCTCTTCGTTAATACGGTGACCGGTATCAAAGTGGCGGTCGTGCTTTTCATCATCGTTGGTGGTTTGGCGCTTTCCGATATG
AGCAACTTCACTCCGTTTGTCCCACCGCGCGAGGAAGCAACAAGTGCTTATGGTTGGCAAGGCGTAATTAGCGGTGCTTCATTGGCGTTCTTCGGCTACG
TCGGCTTTGACGAGGTCTGCTGTCTCGCAGCCGAGGCCAAGAACCCGCGCGCAACCATGCCCATCGCTGTCATCGCCGCGGTCACCATCACAATGCTTCT
CAGTGCACTTGCGTCGCTTGCGCTGTCGGGAATGGCCGACTTCCACGACGCTACAAGTTTTCCAGTGGGTTTCAAGACCCAGGGAGCCAACTGGGCAGCT
ACGATCGTACGTGCTGGTGAGATCATCACAATGCCAGTTGGCGCCCTTATTGGGTTTCTCGCTCAACCAAGACTCAACTACGCTCTCGCGTGCGATGGGC
TTATGCCTCGGATTTTCGCGCGTGTAGATGCAAAGAGCAATCTGTTCATCAACACGTTCATCACGGGCTCTCTGTTTGTCGTCATCTGCTTCAGTGTGCC
ATTCAGCACGATGTGGGACATCGTCAACAGCGGCATTTTGCTCAACTTCGTTCTGGGAAATGCGTCCCTCCTAGTGGTTCGAACACGCAAGCACTCACCT
CGGAAAGCACCGATCGCCATTGGAGCCCTCGTGCTGTGCGCTCTTGCAGCAGCATTCACATATCAGAAAGGGTACGACAACGTGGCGGCAGCAGACCGAA
GCGCTGCCACCCTAGTCGTCGCCTTGGTCTTTGTCGTTGGCACAGTGCTTGCGTGCGCCTACCTTGCGGCCTGCTGTCCGCAGGAAGAACTTGAGCCAGA
CATCTATCGTGCTCCTCTCGTACCGTATCTTCCAGCCCTCTCCATCCTTGGTGACTTCTACATGATGGCCCAGCTGAGTGACTTGGGACTTCAGCTCACC
TTCGCGTGGATTGGCGCTGCCCTCGTATTTTACTtCTGCTACGGCTACAGCAAcTCTGCTGGTCGTTCAGGGTGGGCAGCTCTTCTC