Description :
From Genome Similarity Track
Location :
scaffold_1:49286- 51407
Transcript NameFunction/comments
Plaha_PHALS_12047hypothetical protein

Sequence
2121 bases(100 bases per row)
CACAAGCCACtaaaaagcaaaattatgatcagaagagaAGAGTTAACAAATTGACTATAAAGCTGGAGCTAGTTATGCTAGATACGAAAAATTCCGCTCA
GGCATGCTACCAAAGATATGGGAAGCAAAGAGCAAAGTATGCAGCAAGAAAAGTTGGGCCTTTAGAGATCATCAAGATGATATATCCCAACGTGGCAAAA
CTCAAGATGTCACTAAGCATGAACGAAATTAATATAGCCTTCAATGTTGATATGctacaaaaataaaaatcaaatcCAGATAAATTCCTTCGTCGTCCTA
TCCCCAAAGCGTCCAAGTTTGTGAATAATGACTTAGTGGATCAGCTTCAGTTCATTCAGCATCTTCTAAAGATTATACAGTTTAATTGCCAACCAGAATG
GCTGGTCCAGTAGCATGAAAAACAGAAGAATTAGCTAGCTAGAAAAAGAGAAATATATTCGGCACCTAGCTCATTGGAATGATCTCGTCGTCGACTTTAA
ACAGCGCCAACGAGAAATCAAATTGGGGAGAATGTAAGGAACCATACTCACATGTTCCACGATTCTAAAATACGTTCTAAAATGTTAGTGAGTGTAGGTC
TCATGTTGACGTATACAAAATATACCCACGTTCAAGTAGAGATGATACATATATTCATAGTAGTAAAATGAAAGGCGACATTATAGGAGGAACGATATGC
AATTAAAAATCAGTGGGAAGAAATAGGATAGGTTACATATATCGTAGAAATCAATCCAACAAATAATCTTAATTCTTGATTCGCTAACTAACGTCCAACA
CCTCATAAGTGCAAACGATCCTTACAATTGGTGGCACTTGTTGGTCCTACAAGTCCTACCGATGCCCCTCACACCATCCTCCGCCATGACATGAGTCACA
CACAATCTGATATATATTGTCTTTGTTTAGTGACTGATCCACGAGCAACCACTTCGCCTGAAATGTGCACTTGACCGTGCGTGCTTCCACAAAGGCCTCC
TCCTGTACATCATATTAGCTGGCTTAACGAGCTCTCAGCAACATCATAAGCCCATTTAAAGATGCGCTAGAAACGACATGATGAACATGCTGAGGATTTC
CGTACCAGTTACTCCCCAAGTCGCAACCAAACACCTCTGCCTTCAGATGCCGAGTTTTTTTATGAGGGAGGTACAGTGACTCCCCAAGTCGCAACCAAAC
ACCTCCAACTTCATCGGGCGATATACGACTGAAGGAGGTGCTAACAGTTGTTAGCCTTTATGCTGCACGAATCTCGAATTTCGTGACTTTTCATCGGCGG
ATGGTAATACGACACCCCGCCCTGAAACCCTCGACGATAAGTTCAGCTATTGAACAGAACCTTGCTCAAGGTACTTAGTTTGCTTTACCACAAGTGCAAA
AGTCACGCAAATGTTGCTCAAGTCACGTCGTGATTGTTGATACTTTCATCGCCTTTTTTGGTATTGATAGTGCAGGATTAGCATTATGAAGAACCTGCTT
CAACTACCGCGAATCTGGCAAGAAATGCAACGGCTGTCTTGCCAGAAATCAGGTGATGAATCTGCTCAGTATGCAGCCACAGATGTGCCTACACGTGGGA
CGACAAGGTCGCTCAGTAGTTTAGCAATTTACCACATAAACGGATGTTTTGGTGGACTATGTGGGGCGTCAGAAGGAGCTGAAATATTCCGCGGGGGTAC
ACCTATTGTCATCCGAGCTGTAACTACATTTCCAGGTCCAATTTCGCTGAAAAGTGATTCTTCTTCGGAACTGTATTTTTTCCAGTCCTTACAGCCCTGT
GGCCACTAGTTGTGATCAGGTCTCGCGGTTACATCTCCTGATAGCGTAAAAAAAGCTGTCGTATACACCAGATCAAAATCTTTGGTGATTTTCGTACGGG
ATTCAGTGGCGTTTCATTACCTCCTTGTGTTTAAGAAACTTGCATAATGATGAAGCGAAATGAAACTGATGAAGTTCCGCTACTGAGAAAAAAGCCATAT
GTGACTTTacaagatgatgatgacatcAGCAGTCGAACCCAAGTGCTCATGACTACTTCAAGGTTGCATTGGCGGCTATAGAGGTACCCAGTAGCTACGG
AGTAGTGATGACACCACCTAG