Description :
From Genome Similarity Track
Location :
contig_90:49282- 50671
Transcript NameFunction/comments
g12586.t1hypothetical protein

Sequence
1389 bases(100 bases per row)
ACGGCTCGATCGAGAAGTCCAAGGCGCGCCTCGTGGCCAAGGGCTTCAAGCAGAAGTACGGCATCGACTACACGGAGACGTTCTCGCCCGTGGTCAAGTA
CGTGACGCTGCGCATGATCATCGCGATCGCCAAGTACTTCGGCTGGCCCTCGACCAACTCGACGTCGTGACAGCGTTCCTGTACGGGGTCATGAAGGAGG
TGGGTGTTCTGCGTGGTTCCCGAAGGCGTCGAACTGGATGGTGGATTCGACTGCCTGGAACTGGTGAAGGCCATCTACGGTCTCAAGCAAGCTTCGCGCG
TGTGGAACGAGACCTTCGACGAGTTCATGTGCTCTATCGGCTTCCAAGTGTCGGCCTTCGATCCGTGCCTACATCAAGGTGGTGGACGGTCACTGCGTGC
TAGTGCTGGTGTACGTGGACGACGTGCTGATTACCGGGAGTTTCGCTCGAGCTGATCTCGCGCACGAAGACGGACCTGAAGAGCGCTTCGAGATGACCGA
CAGCGGCAAGTGCGCGTTTGTTCTTGGGATCGAGCTGGTGGACGGCCCGGACGGCAGCGTGACCATGTGCCAGCGTCGCTACGTGGACGACATCCTGAAA
CGCTTCGCCATGGACGAGTGCAAGGCTGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTC
GCGAAGCTGTTGGTGCGCTGATGCACCTGATGACCGCCACGCGCCCGGACATCGCGTACGCCGTTGGCTATGTGTCGCGTTTCATGGAGAACCCCCAAGA
GGAACACTGGGTTGCGGTCAAGCGCATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGCATTTGCTTCAAGCCGGGCGACAAGGTCGACTTTCGTGGC
TACTCGGACGCGGACTGGGCCGGCGACCTCGCGGACCGCAAGTCCACTTCAGGCTACGCGTTCATGCTCATGAGTGCGCCTGTGAGCTGGGGAAGCAAGA
AGCAGTCAAGTGTGTCGCTATCTACAAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAGGGCAAGTGGATCCATCGTCTGCTGTGCGAGAT
TCTGGCGGCTGCCAACGAAACGGGACCCGAGCTCATGATCCGCGAAGACAACCAGTCGTGCATCAAGATGACCAAGAACCCGGTGAACCACGGCCGCGCC
AAGCACATCGACATCAAGTACCACCACATCCGCGACGAAGTGAAACGCGGTGAAGTGAAGCTCGAGTACTGCGAGACTTCTGTGATGCTGGCGGACATCA
TGACCAAGGCGCTTGCGGGACCACGCTACACGGAGCTGACGGCGGCTCTCGGCATTCATGGGACTTCGCATTGAGGGGGCGTATTGAGG