Description :
From Genome Similarity Track
Location :
scaffold_18:492765- 501536
Transcript NameFunction/comments
Plaha_PHALS_05521hypothetical protein
Plaha_PHALS_05522FAM177 family
Plaha_PHALS_05523Predicted hydrolase (HAD superfamily)
Plaha_PHALS_05524Domain of unknown function DUF4208
Plaha_PHALS_05525hypothetical protein
Plaha_PHALS_05526Uncharacterized membrane protein

Sequence
8771 bases(100 bases per row)
TCGTTGGTAATATTTCAGGTCAGAAATGGGCTCTGCGGAAGCCAGCTGAAGAGTGCAAAGGGTAAAATGTGCACAATGGAACTTTAATAATTGACGGTCT
CAGAGTGTATACCAGCTTGTGATCTGGCTTCCCTCCTCCACTGCCTCATTGAAAGTTTCATTCTACAAATTGCTCGCACCTCAGGGTATTGTAAATTGTT
TTCCTTTGCTAACTGCTGGCAAGTGTCGCGAGCAACTCCTGATAGCAATCTCATCAACGAAACTGAACCCCAGCGTCACCAACTGTAACCAGTCCGTCTC
TAAGGCTTCCGGCACCTCCAGTCTCTTGCTGGTACAATCCCAAGTCCTCCGTTTCGTTTCGCAATCACATTTTCACTTGCCAATTGGCTTTTCACGGGCC
AAACGACGCCAAGAGGCACACGCAACCCACGCGCTAAAGTGCGATCCTTCACAACACCTTTCAACACTTCAACTACCACGAGCGAATAGCCCAAGCGTTT
TTCATGCCACTTTCTATCTCGTTTTATCACTCGAAACGTGGTGATATCATAACCAATTCTTACAAGAGTGTAGCATTACACGATCGTGAAAAGACAAAGT
TCAAAATGGCATTGCCGTGCGAATTTTACCGCAATATTTGGGGTTTCACTGAGGATGAGGATGCAGCGCTTCGACGACGCGCTCGATCGACAAAGTTTAG
CTCTTGCCCACCCTCAGCAACATCtcgcaaatttaaaaaaagagtGGCAACAGGTCATCTTGTCGACATTGCACAAGTGGCTCATGTAGTCACGACCATG
TCAGACTTTCGCTCTGATTACGGGGAAGACACAAAAAGGGTTCGGCTTGTCAATATTTGGGATGACCGTAGTCTCGCATTAGGTCTTGAGGCCAATTCTA
ACCATTCCGTAAGTAGCTTTGGACAATGTCCTTCGACTGCTGACACAGAGCCTGAAAAAATGATGTCACCTATCTGCAGTCGCGCAGACCGGATCACTGA
ACTCAGTTGTGAAGACAGTGAAGAGGAAAACAATAGCTTTGTGTCCTCCATGAAGAATCGACACCGACCAGGTGAACTCAAGCGAACAAAAACACCTGAA
GTAATTTTTCCAAGTCTTAAGAAAAATGCTAAAGGGGACCAGTTGACCCGAAAGGAGCTTAATTTGAAAAATGTGCCAGTTTCTCCTCCTTCCTCGCATA
ATGGCAGTCTTATTTTCAGTGCCATCTTTTCGAATCAACGCGATTGGAGCTGGAGCGCGAAATTCCTTCTTGGAATTCATGAACCCATTCGTCATGCTCT
TTTCGTCATGGATCGATTTCTAGAACAATCTCAGAGTCAATCAAAACCTGTGGCTTCACACACGCTGGCTCTCGAGTCGCATGTGGCTGAATTCTTTCTC
TGGTTCAAAACGTTCTTCGTCGAGTATTTGCTATGTCAACATGAGGTCAAAGCCGCTGTGTTACTGCCAATGCTAAACTTGACTGCACCTACGAAGCAGC
AGATTTTGGATGTGTACCACAATATCAAGCTGATGCTGGCACAAATTCAGCAACTTGAACGTGCATTATGTGTCAGCGGTGCTTGCAGTGCTTCATCGTG
GCTTCTTCGACTTCAAGTGTTGCAAAGCGAAATACGACAGCTCAATCGCACGCTGCATTCTGCATTGAATCGGGAAGAGACGACATTGAACGCAGCTATG
AGTGATGCATTCACGGAACGCACTTTTCGAAGCCACATCATGCCTCGAATTTTTCGTGCCATTCGAGCAAAACGCGTGGTCGTGCCGTGGATTGTCGAAC
GCAGCAAGATTTGGGGTGGAGAAACAGAACATCGCAGTATCCAAAGCATGCTGCCCTTTTCAGCAAAGTTCATGTATTGCAAAGTGTGGCGACCTTATTT
TATAAGCAATGTGGCGGTGGCTATGAAGAATCTAAACCAATTTGACAGCTCATCAGACTCAAACAGTAGTGCCAGTAGTGGCTCGACATCTAGCGAACGC
AATGGGGAAATATGCTCCGTTATGTGAAAATGAGGCACTATACTGCTCTTTTTCTAACAGCTTGACAGCTATTTATTCTGAACTAACTCCATCTTAGCTT
GAAGGTGAAGCAGCTAGAATATTTGCATTTTCATACGAATAAatgaaaatgttttttttaaattcgcTTGAACTTTGTGCTCGACGATTGAGACTTAAAA
ACTGAAATGAACTGACAAACGCTTGACGGTTAATGGGTAGTTAGATTTGTTATTGTCGATCGATCAATAACGGAATTACTAATTCCGAATTAGCCCCTAC
ACGTCGAACATAAAACGTCCTGGCTATGGACACGAAAGCTCGTGTTGATGGTGAAAGCAGTGATCAAGCCGTGAAGCATCTTTTGTCGGACAAGCTGATC
AACACAACTGACCAGACTTCACAATTTCTCGAAGAATGTTCCGGTGTGCGCTTGCTGCCTGAATTTGTATGGGATTGGATCTGCTGGTCTGGTAATAAAA
CATTTGACATCTTGGATTTTGCGGGTGAGGTAGTGGCGAACTTTTTAGGACTCAATCAATCGAAATATCAATGGATCATCGATGCTCAAGAGCGTGAGGA
GCAGAAAAAGCAGCAGCGACGACTTGAAATGCGCCAACGTCGTCAGCTTTGTTTAGAGCAACTTCTTAAAACAGAACAGCGTAAACTTGAGGAACTTGAA
ATCGGTGCGCGTAACAAGGAGGCGGTCTTTATTGACTCATCTGACGCAAAGCATTAGGTCGTATGTCGCAAAATTTTAAGAAATAATATGTATTTCGTTC
AATTATGTTTGCTATGCCATAAAGGGTGAGTTGGCGGTCGGACTCCTGCGCGCATCAGCATATGCACAGCAGCCTTTTCAATATACTGCAGCTGTCGATT
CACAAAACTTTCTCCTTCCGGTGCTAACTGCTCCGATCGGATTGTAAATAGCCCTACAATACATCAATTACATCTTTCTCGATCAAACGAACGTAAGAAA
CTATCAAACCATGAAGATTGCCGAACAGCACATCCGTCGAATACCGGTCGCCAATAATTACGAGAGTTTGCGGATCTACTTCGCCAAAGTGTTTTTGCAC
GAAAGCAAAACCTCCTGGTTTCTAAATGACAAACATTTATGTAAATCTCGTGCGAAGTCGGTCAACGAAACATAAATTTAGTTCTACTTTTTGATTGTGT
CGAAGCACTTGGACATGTAGACCCTCTTCGATCTTTTTAGCTTCGATTCCGTCCTTGTCGTCCGTCGACCCAGCGGAATTGGAGAATATAATGACGCCTG
CTTCTCCAAAAACTCGACGGCATTCGGCCAATGACGACACCAAATGAGGACAAAGTTCCATTTTATGTGGCATAGTTAGCGTGTTGTCCTTGTCAAAAAT
AACACCACGAAATCCGCGATCTCGGAGGGTCTGAAAAGGCACCTCCGTCACATCTAAAGCACAAGCTGGGATAAGTCTTATGAAGTGGTCACCATTCAAT
CATAAGAAAGCTACATTTTATCATAGGAGACTTTGTACTTCACCATTTACGGAGAGATGGGGTAGCAAGAGCTGCGGGTGGCGCGTAAATACGCGACAGA
ACTCGACCACGCCGCCTAGATTCAGGCCTTTCATGGCAGACAAAATAAATTACTCTCGAATTTGATTGATCCGCGCTTCTACCAATCATCGCTTTTGAAT
AGGGACAATTATATTGACACCGCGGTTTGTGCAGCATACGCTCATCAATGACAAATGTTCCGCAAGAAATGCACGTCCAGAACGATGAGGTAAACAAGGC
CGAAAATTCGAGCTCAGACGACGACTCGTCCTCCTCAAGTTCGGGTTCTTCTTCCAGCTCCTCTTCATCTGATTCTGAATCAGAAGACGACGCAGAAGCT
GAGAGTACTGAAATAGACGCTAACTCAACCAAGCACCTGATTCCATTTGGAAACACTGAAAATGTCGGCAACTCAAGCACTGCTTCGACATCATCGCTCT
CGGCCCCTCGTCCACATGGACTGGCAGCTAATCAGGAGACCCTTAATGTTAATTCGACGCGAGCAGCAGCGAGatttaaagctgcagagacaGAATTTAT
GATGCCATTGGGTACACGAAAGCGAGATCGACGGACTATTGAAGAAATACAACGAGATCTTCGAGACAAGAGGAAAAAACCGATGGGAAAAATAGCAGCA
AAAATGAGTCCTCCACCTCCAAAAGGCTCGCCATTACGTTctccagaagctgaagcaaTGGTAAGTAGTGGTGCACCAATGGCGGTCGGGGGCTCTTTAA
ATTCGTTTGGAACGGCAGGACGATTGCCAGTGAAGCGAAAACCAGTGTCAGCACACGATCGATTGGCCATGAAACTGAATGGACGAAAGACCACAAGTGC
GAAAGCAAAGAAGGCGAGCAGCTCTACAACGCCGAGTGCAACGGCCCCCCCCGTGGCAGTTATGACGAATAAAATAGTGACAAAAGCCATTGCAGCTAGT
AGCTCAACTAACGCGGCTACAGGGAATAGCAGCAGTAGCGACCATGGAGATGTAGGAGGGGACGGATACAGTAGCAGCGTGGGCAGATCGTCAGCTGTTG
CAATAGATGGTAAAGTGGTGCGTGCGATGTTGCGTGCAATGCTTCGCTATGGAGATATGACCGATGTGGGGCTTTATGCGGCTGCTATAAATTTCGCAGA
CGAGTACAAGATGCCAAATTTTATTGAGCGCGCGAATTTGCAAAGTACTACGAAAGTTTCTTTTGAACGTCTTCAATCTCTTGCAAATGAAGTGGCTCTG
AAGGCCAAGCAAGCGATTGAAACACGGCCACCACATGATGGAATCAAGATCGCTGATGTGGAAGCGAAAGCGTCGCAGATTATTGAGCGTCTttatgaga
atttgaagcttCGTGTTGCTGTTCAACGTGCGTTGCGCACCGCTGGGTGCTCATCAGGCAACGCACAAGTGAATGCTCAGGGCGCGTATGTTTTAGTGGC
AAAACAGAGCGACCTTTCTGTTTTAGGAGTTAACACTCGCGACTTACCAAGTTGGACCTGGGCTGAAAAGGAACATGATTGGACACAACGCAAAGACGCC
GCGCTGCTACTTGGCGTTTACGTGCATGGTTTTGGAGGATGGGAAGATATTCTAAATGACGACTTGCTTCATTTCCAGAAACAACGTGCGCTGAAGGGCG
AGCGTCTGAAAAAACGTGCCGAAAATTTGCTGAAACGATTATCTGCTCCAGATATGGATGCTGGCGAGCCACGTATTGTGCAGCAAGCAAGCGCTCTTAG
CTCTGCTAGCGTAAACTCTAACCAATCGTTAGGTGCGCAATTTAGTGCCATCATTCAAAGCGGAGCAATCTCGGGTGTGACAGCATCAAATTCTGTACAC
TCCGGTACTGGAGGCGGCCGAATGGCCCGCGCAGCCGAACGATTTGCTGCACGGCAACAGAGTAGTGAAGAGATGTCAAGCCGACGTCCTGCTATACCCT
GTAGCGATGGAACGACTTCAAATGGAGACTCAGGACGGCAAAAGACTCCACCGGTAAGATCACCCGCTCAAAATATGGTGGCTGATATTGATCCTGAAGA
AGGCGAAATTGGCGATGCATCACCGGCACAATCGACATCTTCGCAGCACAAGCGAAGATCGTCATCTTTAGAAGACGGGGATATGACAACAACTCGAAAG
AAACATCGTCACAATAGTAGCGATAGCTTAAGTGTGACGGAAAAACCAAAGAAAGAGCTTCGGAAAGAAACAAAGAAGCAAAAGGGCCACAAGTCTCCAA
TTTCGGTGGCAAACGTCGTGGCAGATGAAGCGCCGGAACCGGCACTGCCGCTTTTATCAGCTGAGGAGTGCAACGAAAAGTGGAAACCCAACAAGAAACT
GCGTGACATTCGGCAGGTGCTGAAGAAGATAAAGATTATGGCTGAGTGGTCGAGCAACCAGAAAGATGAGACGGTAGCTGAAAAGATGTTCAAGTACGTG
AGTACAATCGGCGAAGCGATTGATCGGATCGTTATGGAACACCAAGATAAGGTGGAAACCCAGTCACATGGATCACCTCGCGAATCTGATGAACTTTGCA
CAAGTTTATGGACGTATGCCGCGGGGTTTACAACTTTTACACCACAAAGTTTTGAACAACTGTACGATGACATTTGTGCAGATGGCGACGCTCTTAAAGT
GAAAAAATCCTTTTGATTCATGTTAGGAAAGGAAaactataaaaataaatgcatTGTAATTTCTCAAGCGTTCACTACTAAATCGACTGGTAATTCGAGT
CGAAGAACGTATTGGCTATGTTTTTGCAACCACCTCCTAGTGCTGAAGAATTAGCATTGAAGGATGAGATAACACAGGTGCTGACAAGTCAAGGAGTGCT
ATCAAAGCTAAAGGCTGAACTACGCGCTGCAGTTTTTGATGCGATGCATGAACGCGAAGGGTCTAGGAAAATGATCGACGGTCCAAGATTAAGTGACTTT
CCAAAAGAAATTAGCACAATTGCTCTGTCGCTAATTGTCGAGTGCTTGCAGTTCTTTCATTGGAAACACGCGCTGGGGGTGTTACTTGCAGAGACGAATA
CAGAAAAGGAGCAACAAGACGGCAGTGTGCTGGCGACAAAGCTTGGATTGTCAAATTACGACTCTTTGACTTATCCAATACTCTTTCACCTCGTTCAACG
CCAATTAGACGATAGAAACCAGCACGCAGTCGCTGCCGAAACTTTGGCAGCCACCGAGCATAGTCACTTTAGCGGTGGACATGCAGACAACGCACCAGCG
TCAGCAGTAAGAGCAGTGGAACCAGAAGAAGATCATACCTACCAGGTGCCTAAGAAAAAGGATGTAAACATAGATTTTGAAGGCAAGGACGGGGATGATG
AGAGCAATGCTGATTTTGAAGAGAGCATGGGAGAAGAGGCTTTTAGTGTATCAGAACTGGGAGATTCCAGTTTGGCAAACGAAGAAGACGAAAGAAGCTA
TGATCAAACTCTAACAATTATCAAACAGCCCATAAGTTTGTCGAAACATCTACCGCAAAAAAGTCACAATAGCGATAAAGATTTGGAAGACAGCCATAAA
ACCGGTGAAAGTGTTAAAAATGAATTGTCAATGACAGTGCCTCCTCCAACACCAGTAGGTTTGCCATCCTTACCACCCTTAGTCGGCCATGCTCTTGCTA
GGGATGCAGACGATGATTTTGATGCGGTACGTTTTCCATGCTATAATTCTATGACCGAAAGTGCTGAACGGGGATGGTGTTTGACACAGGAGGAAGAAGC
TGAACGTTTACGACGATTGGATGCTGCACTGCAAGCCATGGAGGCTGAAGATGATACCGGTACACTACAGCAATTGAAAGTATCGCTGCAGCTGGAATCG
CACGAGCAGGACAGTTTTGTCAGCAGTGGTGGGCTCGACTCTGATGGGGAGGAGGCAGATGACGCCGATGATGTGATAGGCAATTCGCAAACAGGCGAGA
ATGATGTTGAGAAAGAGAAAGCAGATGACGCGAATAATGTGAATGGTGACCCGCAAACTGGCGAGAACGATGCTGAGGTAGAGGGTGATGATGATTACGG
AACCAGCGACtttgaagaggaagaagagatCGCCAGGTACGATTGTTTGACGTGATATACTTATTATGCTGAGATCATGTTGATACTGCTTTAAACAGCG
ATATTTCCGAGGAGTTGGAATCTATGCCCGAATTCTCGGACAGAGGGGATGACACTGAAGACGACAGACAAGGGATGGCGGCAGCTGACACCGAGCTACC
TCGCGTGCTTCAATTTGATACTCGAGTAGACAGTGAAGATGTGTTGAACAACTTTGACtacgttgaagacgttgaaAAAGATGAAATATGGTAACTCCTC
AAGTAACAAGAAGTCGAGAGTGCGCTTTGTACGTTGCTACCTTCGTTAATACCCCTTGCTTATGGCATTGAAATAAAGGGTATTTGCTTCACTTATTGGC
TCGTGACCTGACGAGTTTGTTTAGTAAATTCTGGTCATCAAAAGATTCTGGGTGAATGAAGTAGTGACGTCCTTTTGCTTGGAATGAAACCATTGGATGC
ATCGCCTGGGTAGGTGGCGATACGTCGGACAGTCGAAAGGAGTGGCGCTCTAATTGAGCAAAAATCGTCAAAGTCTCGACAATCACGGTGCAGCCAACAA
TTTCATCCACTCCCTTGATCAACCACATTCGCATTACATACGGCTTGAAGAGAAAATGGAAGAGCGAAGTCGTACCAAGACCAAACAACATGATGGTACC
GCACATGGCCCACTACAAATCCAACAGTATGTTAGTACCTTACTTGGCTCATTACACCAACCAATAGTGACGTCGATATACCTTGCCGACCGTGGACGTG
TCCTGCTCGCTAAGCACACAAAGCACTGGCATACCAATGGATGTGAGACTGCAGCTGGTAATTGAGACGGCCTTCATGAGGCGAACTGCGCGTGACATGG
GTGCCTGGTACACCAAGTCTTCGTCTAACTGCAACATATCCCGCTGCAGATTTCTCGCTTTCTCATCTTTAGCGTTCAGTGGCTCGTGGGATGAGCTATG
TGGGCGGCTACCGATTCTTTCACTGAGACCAACATTGCGACGGCTGCTGTAGTCAAATGAAAGCTTTTGGATTGCAGCAGTGCGATAAGGACGGGAAGTA
GCGCCTAACGTCGAGAACTGCGAGCGAAAAGAAGATGGAAATGTCTCTGCGAGGCGCGCGACACAGCGTGA