Description :
From Genome Similarity Track
Location :
scaffold_53:49273- 50470
Transcript NameFunction/comments
Pl_111025conserved hypothetical protein

Sequence
1197 bases(100 bases per row)
GTGGCTTGGCGCATCAGCAAAGTACGTTTGTAGGATAAACGCGCGAGAAAGGAGTGGCTCAATCTCGTTTTCAACCCAGTCCTTTGTCGGGAGGCTTTGC
AAAAAGAGAACCAAATCCTGGAACTCCAGCGTCTTGAGCTTCTCGCCAAACGTCATGAGAATGGCAGCGCACACGTACACGTGGAAGCTCTCAAATCCCG
AGTCTTCACACAGATACGTATCCCAGATACGCACGATACCATCCAGTGGTAGCTCGCGCATTAACAAACAGTTCATCCAGCGGAATGCAAACTGCACAAA
CTGCACATTCTCACGCTCTACGATATGCTCGAACAATTCTCCGTCGCACCGGTGGACAAGTTCCTCCATGCGCTGCACCATTCGCTGCAGACCCGGTTGG
GCGAATGTATAATGATCCTGGATGTCGTCCAGGAGCTTCGTCAGGCACCAGTAACTATCCGCCTCGACAATTTGCAGGTTTTCATCCGACACCTTCGACA
AGTCGCACGTCTGCGGCTCATCTGTGTATCGAATGCGTCATGTAAGCCGATATTCAATATGTAAACAAGAACTATTGACGAAGACATACCGATGAAAGCC
GAAAGAAAAACGACTAAGAATGGCATCATGAGGTCGTTGATTCCCTGCACGTAGCCACTTGCTGGGTGCCGAATTGCCCAGATGTATAGAACACGTTCCA
TGCACTGCACACATAGACCAAGAAACACAGCAATAGACCGCTGTCAATGTCACTCAGTGGCCGAGGTGATACAAACATCTCCTCACCTGATGAATGCGCT
CGTTTTGAAAAAGCTTCACGTCAGCATTGGTACGTGGAATATCGACGAGAATCTGCCGCAGCGTGGTTTGCTCACGCGTACCCCGATCCGTGTCTGGAAT
GTAGTAATACTGCTGTAGTAGTTCTACATATTCTTGCCGCTTTCGGTCCAGCATGGCAGCTCGCCGATCCTTCTTCGATGGCATGTAGCCCTGCAGTCGT
ATAAGAATTAGCGAGAATCAAGCACACCCCAGTGACAAAGTAGCAAACATACCAGAAGCAGACGCCAGACTGTTGGTCGATGCTTCGTAGGGATACCGCC
CCAGCTGAGCTTACGAAGCTGGTCTAGATCAATGACTTCCTTCTCCAACAACCGTCCAAACTGCGTGTCGCGAAGGTTTCCTGATGCATTGCGAGAC