Description :
From Genome Similarity Track
Location :
scaffold_43:49271- 74307
Transcript NameFunction/comments
Pl_111307hypothetical protein PHYSODRAFT_309454
Pl_111308anaphase-promoting complex subunit, putative
Pl_111309hypothetical protein PHYSODRAFT_474162
Pl_111310conserved hypothetical protein
Pl_111311conserved hypothetical protein
Pl_111312hypothetical protein PHYSODRAFT_552372

Sequence
25036 bases(100 bases per row)
ATTGCTGTGCCGTAAGTGCAAATGAGAAAACATCGCATTAAGCTGGTGCTACAGGCACACAGTGGATGTCTGCTACCAGGTGATACACCTTGGGGGCATA
CGACTTGACTCTCTCGACGTGCTCACATGTAATAGTCCAGTGTTTGCCGTATTGGTTGGCCAGATTTCGCATCGAGTCCAGCAGACGCTGTTCCCATGCT
TCGCGGTCTTCCACGGCCACGTTGTCGTGCACGTGGAACCAACCACCGCTCGACTTCAACACTTGCACAGCCAACGGCCAGGCCTTCTCACTCGTAGGCA
AAAGTCCCAAGTTCACACGGTCGGCCACAGCACCGATCGTAGGAGCAGACTCACGGTTATCTCCAAGGTAGACCTTGCACCTGTCTGCTACGTGGTTGCG
CTCGAGATTGAAACGCAACGCTGCCACCGAGTCCGGGTTCCATTCGCAAGCATGGACGAACGCTGCACCACCATGTACGAGGAATGGCAGTACATAGTAA
CCGATGCCACAGAATAGATCGACGATGGTCTCACCTCGACATCCGATGTTGGCCATACGAGCCTTCTCAGTAACATTACCAGACGAAAACATGACCCGCG
TGAGATCCCAGCCGTAGATAATACCATTTTCACGAATCTCCACCCAACCAGGGGCTTCCTTACTGCGTTGGGAGGCAAGTGCCTTGTTGTTCACGTATAG
TAACTCCACGTGACTCTGTCGTTTTTCGCTAGCATCGATAAAGGCCTTCCGCGCAACACGAGAGAAAGCAGGAGTTGTGGATGCACAAACGTGTGCCCAC
ATCTCCTCTGCAAATGGTGCCCATTTCGACTCGAGGAAGGAGTCACGTGGGACCAACAAGACATCGCTCACAAACTCATACTTCTCCGGAATAGTCTTCA
TGATCTCTGGAGAAAGCTGGTGCTTGCTAGCAAATGCGCCAATTGTACTACGAATTATTTCGTTGCGGTTCAGCCCACTCGTCTTGCCAAACTTATTCGC
ATACGCATCATTATCGGAAACAACCTCAAGATTCTGCAGTTCACTGTCGTCTGTTGACTCGAGAATTGCACGAATAGCGGGTGTCACGGGGAGCAGAAAC
ATTGTCGTTGACTTTCTGTCAGCACTTTCGTTTGAGTGCGCGGTATTTGCGACGTGAACACGGCGAGACTTGTCGTACACATGGGCCCTCTCCAGTAATG
TCTTCACCTTCTTCACTTGCAACTTTCCAACAAGAACACCTAGCGGTTCATCATCTGAAGAGGCCGCCAAAGACGTAGCAAGCATACTGATTGGATTACT
CTTGGTAGCAGTGGCAGTAGTCTTCTTTGGTACTGTCAATGACAGGTGGCACTGATACGACGACGAATAAAATTGTCCAAAGCCGAAGCATTGGAAGCCA
CCGCCTAAAATGAAAACAGAATTATTGCCCGGCATCCACGCAGTGCTGTGTCCCACAAAAGCTGCATTTTCGTGTTTCACTTCACCAAGGTCCGTCCATT
GAGCAGCATCAACGTCCAGCACGTAAATTTTTTGAGTCGCCTTGTCTCCATTCGCTAGCAACGCAGCCGTCATGCCACCAACCACAAGGACCTGATGATC
GCTGATTGAGGAAGCACTGCCACCAAAAAGCATAGGAAACTGACTCTTGTTCTTGGTGTTTTCGAAGCGCTTGAGTTCGCTGGTCTCTTTGATAGTATCG
AAAAGCAAGCACACGCTACTATCATCGTCGTCGCTGTAGTCGCCGTCTTCTAACGACGACATGCCTCCCCAAAATGCAAGCGTATTTGATTTGACAACTT
CGCCAATGTGATCAAATCGACGTGGAATAGATGCACTATCTGCAACATTTCCAGCAGGTGTAATTGTTAGCAAAACAGCAAAACAAGATTTGGAAACGGA
TAATGCGTACCAATTTGACGCCACTGCGGTGGGTTTTGACCAAGGTCTAAGGTAAACAAATCGCCAAATACTTGGTCGGCATCGCGACCTCCGTACACGT
ACACAACAGAACCAACTGCAGCCACATCGAAGCAAGAGTTAACCAGTAGTTAGTACTCATTCCTCCATCCTCAATAAGGAGTCTCTCATCATTACAAATA
TGGCCTTACCCGCACAACTGCAATGCTTCCAACGCGGCGAAGGACCAAATCCTTCCGGAACAACCTTTTCCCATTGCTTCGTCTCGAGATCTAGAGCATA
TATATCCCCCAGAGGTTTTGCTGGGCTTGCTCGACCACCAAAGACAACCATACGCGTTCTCACGACAACAGCTGAATGGTACATTCGAGCTGATGGGCCA
TCAGCTCCAGCGGCAGCGTGATATACCTGCTGGAGAGAACCATCCTTTGAAGGGGCCAAGAAAGTGACATCAGCAACGCGGGTTGTCGTTCCAGAGGCAG
TAGGTCCTTGGCCACCGAATATCACAATTTCATCCTTGTACTGCACACTCGAGTGTCCCACAAGATTTACGGTATTCTCACCTGTCACCTCCGTCCATGA
GCTCAGCTTAACGGCAAATTCAGTTGCAGTTTTCGCTGTCGACTGACAGAATTTCGCACGGAAGGCTTCACAAAGTCGATCTGTTTTCTGCTTGTTGGCC
TCAAACTTTTGGTTCGCAATATCCACGATCCATCGAAGGTAACCCTCGTTGACTAACAGGTGCTCCGCACTCCTTCCGAGCGGAATCTCCAACCCATTCG
CAGTCGTACGAATTGCACACATAATTTTTCGATTGCCAAGAACAACACCCGACTCACGGAATCCGCTAGCGATACCCCACTGCAACAATTCTTTTGCCGA
TTCCAGATCGCGACACACAACATGCATGATGAACGGTTCATGCTTGAAAATAATCTGCAAAACAGTGTCAAAATGTCAGCCAAAACAACCTTAAAATGGC
TCATATCAACCACGCACCATGTTGCTCGTGCTGGAATTGGCATCTGGAGAGCGCAACGCGGCCACCAATTGATCGAATGTAATAGTAGCGTGTTCAGCGA
TTAGCCACTTGCCACCTTTGGTGATCAGGTCCGTTTTGCCTCCATTTCCATTGCCTGTTGCAACTTCACCGCAGAAAACCGCAATACGACCTGAACACGA
GCTACTTGTCACCTATGACACAAACCAAATGAGCAATATTCCATTGCAATACCCAACCGCTATCGACTCACATAATCCGGATGCGCATTGATCATCTTGA
TCATATCGACGATAGGTTCATCGATGCAGCCCTTAGGGCTTTTGTCTTCCATAGCCTGCAGCTTACGCAGACTCTCGCGCTTGAGCTGCGCGAACATCAC
GGTCCAGTCGTGAAATGACACATGGGACCAAAAAATAGGCTACCCAATATATAGTCCAGTATAAATATATAGTCCTGTACAAATAAATAGTTCATTTTAA
TTCACGATGGAAGCGGAAGATGCGCCGAGTATCCGCGTGCGTTGCTCCGGCGTACGCACCAACGAACGCGCTTCGCTACCAACAGATAATGGTCGTATAT
TCTTCAGTGAGTCGCAGTTCTCTTCGTCCCCGTTCTTAGTGCGTGTAACCTTCGACAGCGTCAGCTTCGTCCATCGCGGGTCACACGTCGTGGAGCGGCG
TTTCGTCTTTCCAGGGCGTATTTTGCACGCTGTGCTGGCGGATTTCTCTCAAGAAGTCTTAAATAGTACAAAAAAATCTAACGATGAGTCGATGGATGGT
GGCAGAGCGCGGAAATCGCCACTAAAACCTCTTCCACATCCTCATTTATGCGTCTTGGTGCGTTCCGACTGCTTAAATGTGTACACTGCAGCTGGAGAAG
TGTTCGAGGTGGCGCTACCCTTCCAAGCCAATAGACTTTTCCCTATGGAAGGGCGAGGCTTGCTGTTACAACGCAGTCCAGCGGTGCAGGTCCCTTCTAC
GCCGTCAAAACGTCCGAGAGACGCAGCAGCAATGGCGTTGGCCAGGAAGAACCGGCGTGCCAGCACGAGTAACAGAGGAGATGGAGACAGATACAAGTAT
AGCTCTGAAGAGAAAGGTGTACCGGCGAGACCGAGGTATTTTACGCTCAGACATCCGCTGGATGAGGTCAAGCCCGTTGCGTTGACTGTGAAGGGAGGTG
TGTCTGGGAAGAGTGAAGAGAAATTTCTATCAGATTCGGCGTTGGAAGCTTTGGATGTGTTGAGAGATGATGTATCACTCCTTTTGGTGGCGTTTCATCG
TTGGGAGCAGAGATTTTGTGTGTTTCGGATGAATGTGGTAGAGAAAGTAAAGAATTGTTTAGTGCCAGAGGTTAGAGTGGTGGATGGACCGACGTGGACA
AAATACCGTGTTAGAAGTGACTTGGATGAAATGCGGGTACGGATTGGACCTGATTGGATGACAACATTAGTGTGGAAATCTCCACGCGTTGGACCAGCAA
CTTCAAAGTTGTTGTTTCTGTCGCCGATTGTCCTGCCATCTCCTGTCGTGACTGCTTCACCTATTTCACCATCGCCGTTTGCGGCCATTGGGTCGTCAAC
ATTATCGGGAAATGTTACCAAGGTGGCATTTATCGCGTCAGATATCACCGGTCTTCCGATGTTGTGTATCATGGACAAAGATGTTGAAACTCTTCTCCTA
AAGCCCATTTCACGTCAAAAAAACATTACAATGATGTTAGACGAAGGCGACTCTGAAATTGGCGTTCGTGTTTTGCATTGCCGCGACGCTGTTCCGATCT
TGCAAAATCATACAAGGTCGTGTGATGGCAATGACCAATGCTTCGAAGGGTTTATTGATATTGTCGTGTTAGAGAAGGATGGTACTCTCATGCTGTATAG
AGCTCACCATCCAATATGCCACCTAAATGTTCCTGGTATTAGGAACAATGATATCGCTGTCAGCAATGTAAGTGAGGGCGACTCGGGGAGAATGCGGTTG
GCAGCCAACATCCAGTTAAATTCTATTGACAACGCCAATGCCTACGAGATTATCTATCCAAATTTTTGTGGTAGCTGGAGCGGGAAGATTTGGCGATGTG
AGCATCCGCTAAAGGTTGTGAAGTCACCCCTGTTACAGCAAGTTTTTGATGTGTTGGATTGTATAATTCCCTCCACTATATTGTGTGAGTTTAAGGCGCA
CGTGGTATGTCGAGCACAGCACAAATCTCAAAACTCTACAGAAGATGACGAGATTAGGGGCGGAGGGTTGGAGTGGCAGTCATTTTGTGAGATTATCACC
AGTCTGCTGCCAAAGCGAACCGTTACCAAAGAATCGTTGATAGCAGCAGGAGCGGTCAGCCATGATGATGGGGAGACAGCTACTACTTCAAATTCGTCAT
TTGAAACGCTTTGCCAGAGTGAATTTCATGATATGTATCAGTATGAGCATGCAATGATTTTCGCCACAATAGAACTACCCGTCACGGAAACAGCTAAACA
CAATCCCAACTCTCAACCCACTAGTCTGGAGAACATGAACTACAATCGACAACGTTTAGATATGGAAGAATATGTGGAAATCATATTTTCGGGACTTCAT
TTGTTGTGCGAGGAATTCAAGTTATCAATTACGCTATTTCAACAGCGATTGCAATTAGCGGAGTTGTTGCTGGATATGGCGTTGCAACTGGGATTGGACC
CTTTTGTCACTTATTATAAGGAGGACAACTGCGTTCTAAGACGCCAAATGAACTCAACAGGAACAACAGGTGAGGTGGGATTCCAGCCAAGGACACAAGG
GGAGGGTTTAGTCCGCTTTTCTGCATATGGATGTGTACCTGACGTGATCGTGTGGCTTCAAGAAAAGATGACAACAAAATTGCACACATTAGTGAACTTT
CCTGCGCTTATTGATAATCCAGAGCAACAACCGCCTATCTCTGGTATCTTGTTCCGACGTCCTAAGAATCCACTCAAGCGGACTATAGCCATTTGTCGCG
CATACGATCTGGTATTTTCAAGTTCAAAAGCAAGCACTCCAGCTTTGCCGTCGAATGCATTCAAGTTAATTGTTTACCTTACTCAAGATCCTATCGGCAG
CGTGCTATCCTTGGATGATCTTCCGGCTGGTATAAGATTTCCTCTCGTCCAAGTTATACTTCAAGTGAAGCACCATCCACCACCATTTATTACAGAAGAC
GTATGTGCGTTCGTAGGACGAGAAGACCTCAGTATCGCAACCGCGGGAGATTTAGTCGACCAGTTTGATTATTCTGAGAATCAGCAACAGCAAGATCCTG
TGGGCAAGTTAGGAGATTCGAGCGTTCCAAGTGAGGATGAAAACCGCGATGACTGTGACGGTTTAGAAGACATCATAAGTCGTAGTCAACCACTTTTTCC
CTTCGACCAAAGAATGAAGGAGGTTGCAAGACTGCTTCGCTCAAGCAGACCTATTTGCTTGAAGTTAGAGAAGACACCAGATCTGTCGGATCTCGACTAC
GCGCAGCAACAGCAAGCTCGCTTGTTGCTTCTCTGCAAACGGTCCATGGCGCTTTCCGTGGCGCGTGGAATGGTCACACTTGGTAGCTTTGATGTTTCAA
CAGCACAGACACAAATATGGCGACTTCATATACCAGCACTGCCTCTTCAAGGTCGAAAGCCACCGACAAATGCGATTGTAGAGCTTGATCTGTCCGGCTA
TGCTAAAGAATTGACATATTGGCCTCAATTTCACAACGGATGCGCTACGGGGCTACGACTTCCGGCGCATGATCTCTCAGGCGTCATTAACCGCCATTGG
ATCAAGTATCATCGGCCGTCAGTATATGATATTCCGCAACGAAACTCAACTGGAAATACAGGGGGGCGCCAGGCACCAGCGACCCAGTCAGTTGATACTG
CCGGTCGCAATATGGAAGAGGCATATGCCGCTCATGCGGGGTTATTGCTTGGAATAGGCCTACGAGGTCATCTCAAGTGCTTATCCATGGCTGATGTGTA
CAATTACCTCTCACTATCAAATGAGTTCGTGACTGTTGCGATCATGCTTGGTATGGCTAGCACTGCTGCACATTGTCGACGCAAACGAAAACAGCTAACA
GAAGCACCAAAATCAGTCACCAGTGATGATAAGAGCCGCACTCCACCATCAGAAAATGAAGACGCAGAGATGGCTTCACTTGGGGCGGACCATTTCTTCT
CTGGTTTCCCTGAGCTTTCGTCATCAGATAAAACCCCACTCCTTGGAACGGGTTTAGAGTTGGCGTTGGAGCGATCGGTTTCCAAGATGTTGTGTCTACA
TGTGCCGTCATTGCTACCACCGCCGTTCGGAGGCTTTTCAGTACCCGCATCCACTCAGACAGCTGCGCTACTGGGCCTTGGCATCTTGTACCAAGGAACA
GGTTATCGTCTGATGACAGAACTACTACTGGCCGAGATAGCCCGTTCACCGTCGAGTGCTCAATTTGTTGGGAACAACAGTAATGCGGGGTTGTCGACAG
CTTCGTTTGATCAGCTGGAAGGTTACGCTTTAGCGGCAGGAATGGCGCTTGGCCTTGTCGTTCTTGGGCGCGGTCAGGCCACATCAGGTGATCCTGGACT
GGCCGATCTAAAGCTGGAGGAGAAGCTTCACAAGTACATTATTGGTGGTGCACAGCAGCACCGGGATACAAATGCAGCTGGGAGTTGCCTCTATCGCGGT
CGTCGTTGGCAGGCATTTGGTAGTGGTGGAAATGGCTTGAACTCCTCCGTTAACGGGAGTACTCCAGGAAATTCAACTCCTAACAGCACTACCGGCGCTT
CCCCTGGCGCTGGACGCGACACAAAACCTTCCAGCGACCGCAGTGGGGCTCGATATGGCGGTGAACATGTGAACATTGGGGTGACTGCCTGCGCAAGCGC
CTTGGCATTAGCCTTCATGTACATGCAGAGTGATAATAAGGCTGTGGCAGCACAACTGGCAGTTCCAGATACACTAGTCCTCCTGGACTACGTTCGTCCG
GATATCCTGTTGGTTCGCACATTATCAAAGAATTTAGTGATGTGGAATGACATTTCACCGACAACGCAGTGGATTGATCAGCATGAAGTCCCCTCTCAGC
TTCTTCACGCATACACGTCTATTCAATCGCATGGATGCGATGCGAGAGGAGATACGAATCGGCCGGAGTATCTAAGTGGTTCGTCATCTCATTCTGATCT
CAACTCAATTTGCGAGGCCTATGCAAACATAGTAGCAGGGGCATGCATGAGCATTGGACTGCGGTTCGCTGGAACTGGAAACACGACAGCTCGGGCCACA
CTTCGCAAGTACGTTTTACACTTCCGCGAACTAAGAACGAAAGCTTCTTCATTGTCATCTTCATTGATTTTGCGTGGAAGTAGCAACGTTGTTGCTGCTG
CTACCGAGCGTGCGACCGTCGAACGGTGCTTAGCCGTGTGTGCACAAGCGCTAGCATTGATTGATGCTGGTACGGGTCATGTGGAAACGTTGACACTATT
GCGTTCGATAACGTTGCGACAACGTGTAGATGCGGCAATGAGCTATGGCAATCACATGGGTCTGAGTATGGCGATCGGGTTGCTTTTCCTGGGCGGTGGG
CGTGCCTCTGTTTCACGATCTAAAAAGGCTATTGCAGCGCTTGTGATCTCACTTTACCCGATGGCCCCCATGAATACTGCCGACAATAAATATCATCTGC
AAGCCTTTCGCCACCTTTACGTATTGGCAGTTGATACATCGCGATTACTGGAGGCCGTTGATGTAAACACTAAATCGGCATGCGCTGTTCAAGTTCGAGT
CGATCTTGACAATGGTTCTGGAGACGAGGCCCCTTATCGATTGCTTCGAAGTCCATGCCTTCTCCCGGATATCTCAACAATTCAACGCCTTGTCATCTCG
GATCCTGAATTCTATCAGATTGAAATTCTCACGTCGCCATCACGTGACGAACGAGTGTCTATAGAGGGTGAAAACATGCGAACAGCTAACTCACTCCGGT
TGGAACTCTTACGAAACAAAAACGTAGTGTTTCTTAAGCGCCGACAACGGAAAGACTTCGGGATCTTCACGGATTTTACGGAGGAGCTAGATCAGCGACA
TGACTTGCATGTTGGGGATCATGTTGGCGGTAACAATAATGATGATCGACTCCGGAGAGTGTTTAATTCGTACTTCACGACGGGTGTCGTGGGTGACGAT
GATGAGTGTGCGGATGGTGAAGACGACTTGGGTCAGTTAGATGTGGCAGATTGGGGCAGCAGTTGGTGGGCAGCTCAGTTGAATCCACGAGCGCTTGAAC
AAGTCAGAGAGGAGGCACAGTTGCTGATGCCACCATATCTTAATGTGTTGCATGCGCTCTTTCGGTTGCAGCAAGTGCCGCAGTTGGCTAGTTCCACGGA
GGTCGTGGACTTAAAAATGTTCAGTGAGTACTGTCGTCTGCAATTGCCTCTTGATAGCTCAGCAGCAAAAGAAAAGGATTCTGAAGTCGTGACAATACCA
GAAATCATGGAGAAGAGAACTTCTTTAGCCGAATTTGGCATGTGGTTGTCGACCCAAACAGAAGACGCACTTGGTGCCCTATGGCATCGAACGTTGTTGG
ATATTACTTCGCTAGCTTCAGCGCGAGTTCAACTGCTAGTAGAAGATACGCCATCGACGTCGTCTTCGAAACCAACCCAGTCTGTGGCGGATGCATTTTT
TAAGAGTGTGCTGGTGCGCTACTTTGCTGGTCCTTCGGTGTCTTCGCTTCCTATTGTTAGGCAGCCTAGATCTGTTGACAAAGATTGGAAGACCAAATTC
CAACGAGTTCTAGCGGTGTGCTCACAAGTCCAATTTCGACTGGCGGGCACCCAGTCAACAGCACAATTCCAGCTGGCTGCTTTTCTCGAGCAGGCTGATC
TTACGGAAGGTGAAAAGACTTTCTGGCTGAAGTTAGTATCGTTCTTCCTGTTTTCAAACTAGCTGTGGAGTCGCAAGTTGAGAGATGGTACTCGATGACA
AATCGTCATTGACAATAAGCTGCTATGGTTTGCTAATGTTATTTAGTTTTTATTGTCTTGCAGGTTTGATCAGGAAACTGGTTGCACGAAGCTAACAACC
ACCGTCCCGATCTGCATGCAAGTTTGTTTTTCCTATCTATTCACCCATACCGGCAAAAACGAAAGTTCAATTTTCGTCAGGGATGGAGACGTCCATTGCA
GTTTTTGTCTGGTAGCGCCTTCGTCGCTGTCGTTTGCGAGCTGGAACGTATACATACACGCACATGAGGCCGGCTCAGCTCAATCTGAAATCTGCTGACG
CTCACCTTTGTCACCTCCCCGCAAGCTTTGTCCTGGTTGTCGAGATGCGTCCGCGCGAATCCTCGCTGCTGCTACTACCTCTACTTTTTTTCTTTGTGGG
AAACAATTCTCTTTTTTCTCCGTGGCATGCCACGGTGTTCCTCTTTTCTTTTTTTGCCATAGCCACCACTGTCTGGGCACAACCTCCTCAATTCAGTTTG
GCAAAAGTGATTTTCATTTTACGTCTTTTGCGCGGCGACGACACGGCTGGAGGAGCCGCTGACAACTCCATGGGCTTCTTCACCACCTTCACAAGAGGTG
AAGTAATCCCTTGAGCTGCCGCACCATTTGTCGACGTATTGTCAGAGTTGTGAGCAGTGCCCAACGGTTTCCCGTCCGGGTTACCTGCACCACACACAGC
TTTGCCATCACGGTCACGCTTACCTGTCATTTCTGGAGATGCCACCGACACTACCTTCGCCTTGAGCGGAGTGTTGTTAACCGAATCAGTACCGTTCACC
TCACCTCCATCAGCCGCAGGATCAGGACTTCCTGGTTGCGAAATGCTGCCCTTGCCATTGGCCATCTCGGTTGCAAGCGAAGCTGCCTTCTGACTGCAGG
TCAAATCATCACCATCCTCTTGTGAATGCATACCCTCATCGCCCGAAGGTGGAGGGCTGGGAGCTGCAGCCTCCTCAGCCTTCTTCTCCTCTTCCTTTTT
CTTCTTCATGAACTCACGACGAGAAACACGTGCAACAGCTCGTCCACCCATATCTTCGAATACACTCTCCGGCAACGCTTTCCAAACAACCGGAGTAACT
CGCACATCCATAGTAGGCGTTCGCTTGTTCCAGCGGTACAGGTCGTTGTTCTTGAAATACTCCACTGAGCTATCGATACTCACTTCACGACTGCGCAGCT
GGCGGCGGTCAATGTCGAAGCCCACATAAAAGCAAACACCAAACTTGGTGGGCTGTGCAGGAGCTTGACCATTAGACTGATCGCCCACCAAAGCCTCTCC
ACCTGTAACATAGCTCAGAGGGAACTTCTTCGTGAACGCCCGCAATCGGCAGAGAGCCGGGTTGTATGCAAGAGACTCCACTAACTTTCGCATACGAGAC
TCGCAAAATCCGCACCATGCCTGCTCCTCATCCTGTTTCTCCGTGTACACCTCGACTGCGAGGTAATGTTGGTGGACAGCGAAAAAGTCAGAAGGCTCAA
ACAACGGTCCCCATTCCGATCCACCCTTGCTGAGTACGTCCTGCACAATGGTCAAGCCACGTTTGAACTCCTCCTTCATCACTGTCAAACTGTGCGTCGA
CACGTTAAACGAAGAATTCATCGACGGGTACGCCGGCGTCAGGATCGGCATCACTTGATATCTAGTCATTGAGCCTATGTCAGTAATGCAAAAGAGTAAA
GAATAAAAACGATGTAACCTTACCGATTGTGCCCCGCGTTAGCGTTCCAAACCTCCAGACCGAGGTTAGCGTCGTGCGTCTTACAAAGTTGAATGGCAAG
TGGCCATTTCCAATTATTGAGTACCATGAAAAACCGAAGTAACAAAGTCGATGGTGCTGCGGTCGGATAGAGCTGGTTAATAAAGCACACCAAGATGCAC
CAATTGACACCACCTAGATATCCCATCTTGTTCGAGTACAGTCCGCGTCGTTTAGCCCATCTTCTCACAATGCGCAGGACACTGATGAAACTCTCTCGGT
TCGGTGTCAACTTGATCATCAGTTCCGTGACACGAGGACCATTGAGACTCTTTTCTGTAGCTGGATCCACTCCAACCAGCACATGATCATCTAAAATATT
GAGATTTTCCGGAATAGAATTCCGTGGTAAGATGGCAATTTGCAGATCAATATTGATCTCTTCATAGTCGAATGTGATCAACGGTACAATTGCTCCTTCA
ATCGCCACGAGGTTCGAAACCTTGGGATGTTTCAGAAAAATCTCCTTCAATGACGAGAAAAAGTCCTCACGCGTCACATGACGTGGCGCCACACAGATCG
TGTCAATATCCGCTCCAGGTTCATTCACACCGAGTCTGTACGATCCTGAGACCAAGATCTGGCCGCCTGCATCAGCCGCCATCTCTTCTGGCACGCCCTT
CTCCATGCAAACCTGCTTCACCCATTGGCGGAAAATGGAACGCAGCTCTGCCAGAATCAAGGAGCGGCGTGTGATGTTTTCGTCCGACTCGGTGGGGAAG
TGCTCATCCATGAAGCTCTGGAGCTTGGTCGACTGCTCGAGATCCTTGGGCTCCGGCGGCGTCGTCCGGATGGCCTTGTACGCCTGCTCCAGCACATGCG
GCGCCACGGTGAACGTCGAGCTCTGCATAGGACGACGGACGTTTCGACCTTGGGCTTGCTTGCGACAGTGCCAATCTGCTTCTGTCAGTCGAGGTTGGCG
CTGTCTCTGTGTCGCTCATTGGTGGATATCGCTTCTAGATTTCATTGGACCAAAAGCGTGCGTCTATCAATAGAAAAACATTTTGACCAATGATAGCAAA
TGTCTAGTTTGAATTTTGAACTTCGACGGAAATCCGCATTTTCGCGGTTCGAGCTGCCATGGACGACATTGAGGCGCTCATGCCCCGCACCAAGTGCGTT
ATCCCTTGCGCTAAGACGATGAAAGGAAGATGCAGTAGATTAATATACCTTCTTCTGTGACTGTACAGGGCGGCTAATGACCGCGCGTCTGTCGACAAGG
CCAAGATGAAGCAATATATGGCTACAAAAAATGCGGCTCACAGTGTTGGAGCGTAAGAAGCTACGAAATAGTAGAATTATTTATTATTATTAATTATTAT
AATTATTTATTACTACAGACGCTCGGGTGTCGTGGTGCGCGGTGATGTACGCAAAGATGCGGAAGGATTCGAAGATATTGACGACTTTTGGGTCGATGAA
GACTCGATGCAGGACGACTCGGTGGATGATGACGACTGTGCGAGCTGTTGACCAGGTTACAATACAAGAGAGGACTGACGCTGTGTGATATTTATGTGAA
CAGCACTGACAGTGTCAGACAAGGAATCTGCGGACACGTCAGGAGACATTTCAGAGCCTAGTGAGCATGAGGTGGAGCTACCAGAGATTGACAGCCCCAT
TATGAGTGACCGAGAAAGTATGGACATTGAGACAGGGATGATTCCATCTCGGTCACGATCGCAGAGAAGCAGTGGCAGAGTGGAGAGAGAGGAGAAGAAA
GAGGAAGACGTTGGGCCTGCACTATCCTCTCCTGTACGCAGTGATGTGTCGTTTGATTTCGGCGGTTCGCCTCATGGATCTGTGGACATGAACGCTGACA
AGAACGTCACGGTCCGTAGAAAAAAATCTACTGAGAAAGGTGATGACAAATCGAAGGCCAAAGCTCGTCGGCGAGAATCGTTTGGCGGACCTGGTTTTGA
CGAAGATATGCCCAGCCCGTTCAACATGAATGAAGGTGCAGTTACTCCACTTTCAAATGGTTCGTCTTGCTTAATAGGATGGAGCGCAGCTGTTCCAATG
TTTCATTGTTGTACTAACACTTTGTGCATTTTGCTGGTGCACTTACAGCGAGCAATCGCACCTTGCAGTCAATCCCATCGTTTTCGGACAAGAACTCACT
CTCGCCTAATATTAGCAAGGAGCTATTCAAGAATGGTGCTGGCTACGGTAGTGATGCCAGTGACGAAAAGCCTAAGAAGAAGCAGGCGAAGGGAAAGAAG
CCGAAAAAGTCAGCAATAAGTAAACAGTCGACGGGTGATGCGAAGAAGCGTCGACTTCGACCCACGGGCAATTACGGCTATCGGACCACACCACCAGCAA
CAGATACCTCGATCCAGTCGGTGCAGACAGACGATGATAATGACGAATCCTTTGAGGCCCAGAATGACTCTGGTGGAGAGACTGGAGATGACAGTTTCTA
CAACGAGCCTGATGCACCAACCGGCCCAGTTCGAGACAGGCTGCCTGACGCGTCAAAGATTTTGGACGACGACGAGAATGAAAATGCTTGGGATGGCAGC
GGTTTGCGTCGCTCAAAGCGGAGACGTTTTAAACCGCTTGCCTGGTTCAAGAGCGAGCATATGGTGTACGAACGTACTTTCGTAGGTGTGGGCACAGTAA
TGCCTACGGTTGTGGGCGTGGAACGACTCGGCCATGACTCACCAACGTCGAAACGAACAAAGGCCAAGCCTCCGTCTAAAAGGACCAACAACAGCAGAGC
ATTGACTTTGAAGGAGTTACCTAAGGACTTGCAAAAGAGGATCGTCGATAGCGAATGGGCGACGCTGTACGATGGCCAGGCTGGTTGTATGAACGATCTG
AACATTATCTGTCGTTCGAGTGAGATCCGTCTACGCAAGCTTCCTACTGAAGAGAGAGGAGGCGCTGTGGTCCACGCGTACGCAGGACAGAGTTTCAACC
TATTCAGTCCATCTCCGTTTGCTCGGTGGATCTCAGGGCGTGTCGTGTTGCCTCCTGGTGCGTGGAAGGAGCCCGAAGGTGTTGGCCAAGCGGTGCAGTT
GTTTTACGTAACAGGATGTCAGCCAAAGTCGCTGGAGTTGGCGCTGGCCCCTGAGACCGACGACGACTTCTTCACGAGCAAGCACACGACGCACTTTTTG
CTCAGCCCTGGTGACGAATTCTATGTGCCTGCTGGTAACGTATACTTTGTGAAGAATCACTCAAGCTCCGCGGATTGTGACTTGCGGTTCACAATCTTGA
AGCCTGAAGCGCCGCAAATGCCGTCGGATGAAAACGACTCAGACGCAGAGCAGGAACAGGAACAGAAGGGGTCTACTTCCACCGAGACGAAACCTGAAGC
GATCGAGGAAGCGAGCAGTCCGCTGAAGCGTAAGCGCGAGGAGGATGCAAAAGCCGACGCAAGCGGTGACTCCGATTCTGTCTAAGACGGATGATGTACT
TACATTCTACAGGTACTGTAGCGGTAGTGTCCTTAACAGTACCATTCGATTCGTGTGCAAGTCTGAGATTGCGACGGATTTTTACCTCCGTCGTGACATT
GCTGTCACTGTAGTTGGACCTAGAGCCGGAAAACTGTCTGACTCGTCCGGATATAGCATCGACGAGCGGCTATGGAGTGTTTACTTGGACAATGACACCA
TCACATCTCCATCCACACTAAAGACAGACTGCATGAGTATCTATGTCCATGGTGTATATCAAAATCAATATTTGAGACGTTACATGCCACCACTCCATTC
GATGTGTCCACAGACAATCGTTGAGCATTATTACGGGCAAGTGAAGCTCGTATAGAACAAGATGTGGCGAGTCTCGAATTGCACGCGCATCGTCAACTCG
AACGGGATCTATGCGCACTTACGCATGGGCGAATCTCTGCTAGAAAAGCAGCTGGAACGAAGCTCTCGAGTGGATAGAATAGGTGAGACCCGCCCAGCTG
GGCCTAAGAATACGCGTGGGTCGTGGTTCGGTGTCTTGGCGTAGCAGACCGAGAAGCACGGCGACGTTCGTATGCACCAGAGTGGAAGAGATTGTCAGTG
GCAAACGGACTGAACATCGGACAGCCAAAGGAGCAGAGGACCAGCAGGTTGACATTTGTCTGCCCTATACGCTCGGAGAAGACGGTGGGGCTGCCGACAC
ACGATTGCATAGTTATCAAGGCAGCGCATCAAGCGACTTGATACGGGCTATGGATCCTGCTGCGTCGTCGTCCAAGTACGTTTAGTTGCCTTGGTTATCG
CGATTCCCTTTACTGATGAAGTTTGAGACAGAATGGACGATATCTACGAAATCATTAAAGAAGGCAGCGTCGCAGTCCGTGGTCATTTCATGGTATGTAT
GCGCTCGGTATGGCCGACGTAACATGGTTGATAAGCGTACTGTGGCTAACTAGTCATTGCTTTGCTTTGTAGTGGCGTGACCGATATGTTATTATCAAAC
CAGGCGAGGTTGTTATTCGACGTCGACGAGAAGGTTCCATCAAAGCGAAGGTTAGTGGTTCATGCATTGCTACACAATAGCTCAGTACTAATGGCTTCTT
GTTTACTGCTAGATCGATTTGCTCGATACCAACATTAAGCTCACGTTTCTCGGAGGGCAGTCGCTGCTCACGATTTCAATGCATGGTCGGGATTCAGTGT
TTGATTTTCGCTCTACTGTGACGCGTGACGAGTGGATCAGTGCCATTGTAAGTGCACAGGAACGCCCAGGTTCAGATGTGGATTGCGATGAAGATGGAAC
GGAACTTCTCTTCGGCGATGAAACAGACGACCATGAAGGACACAAACGCAGCTCGATGACATCCATGGGAACTGAAAAGAGCGACACGATGGAAGAGGAC
AGCGAAGGCTACAATGACGCACTGCTGGCGTTGCAGAGTGTGCGCGACTCCGTTATGCAGTGCCATCTCTCCATGGGAGCGGCAGAGATTGATACTTTTA
TTACTCCTCGCGACAATCCTGCAACTCCAACTTTCACAAAGGCTGCACCTTCTCTTCGACGAGTACAGAGTGCAAAACGCAGTGAGGAGGAGCTACGACA
GAAGCGGCTCCGATCTCTATTGACGATGATTGAAAGTTCTCCACACGGTGGACGCGTTGTGCTTTTGCATCTTGGAGTCGTGGCATCTGCTGGAATTGCT
GTCGGTGATATGTTGTTGGCACTGGGAGAAAAACAGAGGGACAACCCTCGTCGTGGTTCATTCACACCCCGCACTCTGAGTACTCAAAAGCACAACGTTG
CAGTATTTGTTCGGGATATTCTGTTCCACCCTATTTATTCAAAGCGTGAGGAGGTGAACACGGAGGTTGTACAAGGACTCATTGACTTGTTCTTCCCTCA
CTGCCGATTAAGGAGATTCAGTGACGACACGGAGTGGCAGCAGGGTCAACCAGGTCAGTCAGGCTCTGCAAACAATTCATCCAGAGTGACAGCAAAAAGT
GAAAATGATGCTGGTGTTAGTACCTCAACAACTGCAGTACCTGCAAATTCAATTGCAGCACCTCTAACCCCAAATCCAGCTGTACGAACTCCGCAAAGAA
GAAAGCGACGGAACCACTCGTTCCCGAACTTGGGGGGTATTTCTCAACTGGCCAAAAGCAAGGGTTTACTACAAACATCAGCCGATGATAACGACAAATC
CATCAACACGAGCAGGTTCGAGGAGAATGGTCAACGACTGCGCGATAATTTGTCGCTGTTGTTTGCTCCGATGCTCCCATCCCCAGGGCTTGGTAGCGGA
GGCACCATCCCGATATTAAGCCCGAGTACACCATTCACCTCCAGCTCACCCGATGAACTCGATCTAATCTGTGAAAATATTCCGCTTCCTGTACCCCTGC
GAAGTTTACTGTGGGAGATGTCGTGCTCCGAGATGGCTGAACAACTTACAATTTTTCATCATTCGCAGCTCAAGAACGTGTATCCATGGGAGTTTTTGCA
CCACCCGAAGCAGGCCGCCAAGGAGCTGACAGATCACTTCAATCGGTTAGTGGCGTATTTCGTTTGGTCAGTGTTGGTAGAGGATTCCCCCAAGGAACGT
GCTGAGGTGATCGAAAACATCATATCCATTGCAATGGCAGCAAGCGCACCTCCGCTCAATAATTTTCACTTGGTTATGGCTTGCGTCGGCTGTCTCGGTG
ATATCCCATTAATGTCTTCACGAATGCCTACGACGTGGAAGAAGGTTCGTGCAAAATACAAAACACGTCTTGGAGAGCTCCGACGACTTTGTGATCACAC
AGGTGGCTTCGAAAACTTACGCCGAAAGCAAAGTACTGAAAGCGCTCGATCCGTGCTGTCCAGCGATGTAGCAACTGCTTCACTTATCCCTTTCATCGGT
GTTATTGGAGTCATGCTTGAACGATTGCGCTCAACTAGCTATTTCACTGTAAAGAAGATGCTGGACTTGGAAAAACTTGAGCGTCAATATATGGTACTTA
ATGTGCTGGAAAATGCTTTGCTGAGGCCCGCTCCACGCCCTAGTCGTGTACCCCGACGTGGAAAAGCAGCTCCAACCGAATCGGCAGTTGAAATGACAGC
ACGTTTGCAACAGTTATTTCATGGTCTCAACATGGATTTTGCCACTGCTCGATTCCATCAGCTACGCTCTCAGCAAATTCTGGTAAATGAAACGAGTACA
ACGAGTTCAGCATCAGCGTCGTTTGTTCTAGGGGCAACTATGAACGGGAGTAGCAGAGGAGGGGTACCAGTGGCAGTGAATCCTGCACCTAGCAGATTCG
ATTCTTCATCGCATAGTTCCATTGGCCCCAGCGAGGACTCTGGTTTGTCGTTTGTCTCGTTTCGAGATATCTGCGTTCTGCTCGTATCCGTACCAGACAC
ACGCGAACGAATGCAAATGGCACTTGAAGCGCTGTTCGTGGATGGTCGACAGCCAGCTACGCAGTTCTTGCGTAAGTTTTGGCTTGACTTTAAACAAAAC
GTTTGGATATCAGGTGTAGGCCCCACCCTCCAGAGTGTGCGGCTGTGCGTATCAGTTCTTTATCAGGAAGTCATGACGTACAAGATCATTGAGCTCATGC
AGATCAGCGGACTTGACGAGAACTCGAGTGACTTACATGACATGGTCTACACGAAGATCGTAGTAATGACTGTGCAGCCAATTTACCTGAAAATCGTGTC
CAAAGTCAAGCGCAACTACGTCAAGGAGGATGCCCATGCATCTGCCCGGTTGCTACAGAGCACTCCTCAAGTCGTTGTCGATAAGAGCAAGCCGACGATA
CCGTGGAGCAGTTGCAGCTGCAGCTCCCCCGTTGAACTGCTCGATCTCGTGTGTCAATTAGTCGCGTTGCCTCGAGCTAGCACAACCACTGCAGCTGCTG
CTGCTACCGATCACCAACTCGCAGCGGTTGAGCTGCTGGGAACCCTTCAGCACCAAGCGCGTAACACGTTCCTCGCTATGAACCCGGTGAGCAGCTTGTA
CTTGATGAAGCAGATCCTGGACCCGAAGTACCTGCCTCTTGCCAGACGACAAGCTCTCGACGTTTTCGAGGCTGCAGTCACATGGCTTCGAAAGGAGCAG
CGCACCTCGAACTCCCAGCATACGCAGATATAGCGGAGAGACGCGAATCTTCCAACAAGTGCAGACAAGGCCAGAGCGACAGCCTGTGCCTATCGAGTCA
TTTTCAGTGAATACGATTCACAGCGACAGCCACTCGTTCGCCACCGAGCGTCGAGACGACTGCGCAATTTTCCTATAAGGCCATTTTCTCCACGAAATTG
CAGAGATGCCCAGAATATATTATATCGCGCCACTTGTATCATCCTCCGCGCGACTTGGCATGCGTTGTAAGCTCCCTGGAGAACCATGTATTTACTCAAA
GCGTTAGCGCAATCTCCAACAATTGAAAAGTGAAGGTGTTACACCTTGACAAGCCAAAAAGCGTATCTTCTGCCTTTACAGGCACACTGTACCAATTGCA
AAGACAGTGCGGACGTCCTTTCGTCCGCCAATAGCCTGCCGTCTCGCTCGATTTTCCGGTCATCCCATTGGTAGAAATCGCGCACAGTGGCCATGACTCC
AATATGGCTTCGTCACGTCGTTAATGGCTCTCTGTGGAATGTGCGCGCACTCGTCCGCTGGCGAAAGAGCGGCCTGGCTGCATTGCCACACACCTCCCCC
ACAAGGTCTCGCAGAACCCCAGCTAAATACTTCGTAGTCTATTAGTGACCGCCACGGTGGCGCGTACTGTGACATCCTAGTCCGTCCCATTTCAGCTCGA
GGATACCCTGACACCGAGCGGTGCGTAGCTCCCTCGAGGCCTTCCACTCCTTAATATTCATTCAGTCTTCGTCTCCAGGGTCTGGTGTATTTTTCTATGC
GCGTGTGGACTCTGGCGCTCAGCATCTTGGGGCTGCTCCACGCTGCTTCAAGCGCTAGTTCCTCAGGTTCCAGCGCGACAAGTGGCACACTCAACACTCT
CACGACGAGCTGCAATGGAGGCTGTAGCAACAACGGAGCCTGTGTGGTCGTGGGTCAGTCCTCGGCCAACTCCATCAACTGTGTGAACGACACGAACTGT
GTCACGTTGTCGTCGGGACAGTCAGCACTTTGTCTCGACGCCTTCAGCTCAAGTGCTACCGAGTGGGTTTTTCAGCCGGCTGAGAGCAATGACACAGCAG
GTGCTGGGCCTTTTGAACGAGTGGGGCTATTGCAGTTGGACGATCATGTTACAGATCTGACGTTCAGAAAAGCAGATCAAGGAGAGGAACCGCTCACTGG
GTCGCTGGAACTTGCGTCCATGAACATCCAGCCGGATACCACTTTGGACAAAGTGACATTCTTGAATCTGACATTGTCTGGGCTGGATAACGCCCTACCA
CTCAATAGTGTCAAAAGAATGTGAGTAGCTGTGGTAATACAACCCGGTCACGGAATGATTGACAAAACGTTTTTGTGTGTGTGAACAGATACTTCAACAA
CTGCTCACTAAGTGAGATCCCTACGTCTGCTATTGCGGGAGACTCCGTCACCGTCATGTACGAAGCCCTACTATTACAATTGTTGCAGCGAAGTTTGTCT
CATCATAATTATCTGGCTATCGCAGTGACCTCGCTGGCAATGCCATCACGACCGTGGACTCCGCCTTCCAAGACGAGACCTTCACCAACCTTACCCTGCT
GTACGTCAAGCCACCATGGATTTCCTGTTACAAGGATTACTAACAAAGATCTTTTGTTGTGTGCAGGGATTTATCATCGAACGCTCTAACAGACTTCGAT
CTAGTGGCGGACAACTTCCCAGCGATCACAACCTTGTAAGTGCTGTACTAGTCTTGTCAATTTCACTTTTCGTACTGATGGCTTCTCGTGGCACAATCAG
ATATTTGCAAGACAACTCGCTGAAAACGATCCCCGACGTGATTTTTAATTTGTCAACTCTGCAGTTTCTGACAGTGGCTGGCAATCCCATTAATGCGTCG
GACCTAACAGTGCAGCAGTTCACGTTTCTCGCAAATCTGCAAATGTTTACGATTGACGGTACCACCAACACAAGCGCATGTCCGGACACTTCAGTTCAAA
GCGCGCTCAATGATTCTTTCATATTTTGTGTGGGAAGTGATGGATCCGCGAACACTACTGTCACAGAGCAGCCTGCAACAACTGTTCCTGCATCAACTGA
AGGCGATTCTTCGTCTTCTTCATCAAACAAGACGTGGATCATTCTCGGCGCGTGTTTGGGGGCTGTCATGCTCCTGCTATTAATTGGTCTCATTTGGTGG
TGTTGTCGTCGGCGAAGAAATGAGCAACCCAAGCTCATGAACAGCACTATTCCATCAATTGCGATTGGCATGGGCGACCTGTCGGACCATCCGTATATGG
AGCTCGGTGTACCCCGCTCCAACGCCTCCAGTCAGACGACTTCAGACTTTGAGTTGCTCGCGTCTGTGGCAGACGGTTATATCGGCTTGACTCGGTTGTC
CTACGACGACGTCTTCATGCACAAGATGCTGCGCGTGAGCAGCCGTTCCGAACTGTGGCTGGGCGAGTATAAGCATGAGGCTGTTCTCGTCAAGAAAATC
AAGAGCAACACAGCTTCAAAAGCGCTGCTCCGGGACTTCGTAACGGAGATTGAACTCATGTTCGAGCTCAAGCACCCGCGCATTGCTGCCTTCCGAGGCG
CTATGTGGGACGCAGATGGCACGGAACTCTGCGCTGTCGTTGAATATGTCGACAAGGGTGCGCTACGTGACTGCACCATCAACAATGTTATCGAGTTGTC
CGTGCCGAAGCAGCACGCCATCGCTCGGCAAATTTCAGAGGCAATGGCGTTCCTGCACAAGCAGAACATTGTCCATGGTCGATTGAATGCGTTCAATATT
TTGCTGGACAAGGACTTCTCCGCCAAACTGAGTCTCTTCAGTATTTTCCACTACGTCAAACTTTCACCTCTGGACAATGAGTGTAAAATCTTCGTGGCCC
CAGAAGTTCTTCGCGGCGAACAACCCACGGAAAGATCAGACGTCTACGCATTCGGCGTAGTGCTTGTGGAAATCGATACCGGTGAGACTCCGGTGATGAA
CGCGCGAAAGTTATCGATGGAGAGGTCAAGTCGCGACGATCTCTCCCCAACTGCGAAAAAGACTGGATTCCGCTTGAATCGCCTTTGCTCTGGTGTGATG
AAGGAAACCATCACCGCATGTCTGGACAAGGATCCCGCGCGACGACCGACGATGGCTGACGTAGCGTTGGCTTTCAACAATGGTGCGATGAAGCTGTAGC
TTTCGCTCTGATCAAATTGGCAAGTCATGAAGTCGTCCCGAATCTATTTTATTTCTACGAGCACGGACGCCATCTGCGCCAGATGCTGCTGCATGAAGCA
GATTTCACGGGAACATGTAAGCTCACACTTATGTAAATGGGATGACCCACCAAAACAGGAACTCAATTCTTATGTATAAAGAAAACACAACTTGCAAACA
TTTACCTCCATTGATTATTATTGTCCGTGACTCATCGTGAATGATGCATAAGTTGTGTTGATTTTGTGGAATTCTGCGTACGATTCTTGACGTAAAATTA
AAAGAGATTGTATTGTGACGAATAAGCATTCATCATACTTGACGTCACGTTATACATAACATTCAGCAGGCTTCGGCTGAAAAAGGAGACACTTGTGCTT
GGAGTGCATATTACTGTAGTAGCATCTCGTCAAAGAACCTGATTACGTGAGTACTCGGGTTGAATATTATCCACGCAAGTGTGCCACTAATGAATGCGTC
GCTGTACAACGACTCATTTCGCTGCGCATATTTCGCTGCTCGGAGCGGAGTGCCGCATCTGTAGATGCAATTCAAACTCACCGAAAGCGAGTCTCGTCTT
TTCGGTGGTCGTTATGAAATTCGTTCATCAAAACACGTTAGCAAAGTTGGACAGCAGCAAATTGCAAGAAAAATTTGGATTGCCCTTTTCTACAAGCTCG
AAGTGCGTCAAAACTATCGTGACAATAAATATTCAACGCGCTTCCCTACTTCCGATTTGTCCCCGCAACGAGCCTTCAATGTGCTAGGAGTAGCTGGAAG
TCTCCTATGATTCTCTATGCGCACACTCGCAAAACGAGCGGGGACCACCATCATCGTTTCCCAGGATTCTGCAAAGATCCAGAGTTGGTTGCTTGATGCA
AGGAGCAAACGTTGCCGTTGCGCTCGTAAGCAGGTTTACGGCATCCTTCCACAACGCATCGCTTGCCTGAAACAAAACAAGCGATAAGCAACAAATACAC
AACAAGGGCAAAAGCGACAAGGCGAAGAGAAGAAGCTCCAGTATGTGAGTACACAGGCAGCCTAAAAGAGTCAAATTTGCAAGAGAAATATACAATTCAT
GTAGCTCACCTCCTCCGTGAGCCCAGCAGAGACCATGCGAGACCGCAGTCTTGGTGCAGTTTTCCTCGCTACATTTGCGACCTGAGCAAGAGAATCAAGT
CAGATGGAAGTGAATCAACAGAATACAAAAATGTTCCCGTACCTCCGCCATGAGACCAACAAACACCACGTGACTTGGCACGGTTTTCGCATCCTGCTAC
AGTGCACTTAGTGGAGCCTCCTGCACGTGTTATTATCCGCAACGCTGCTTTAGCAAATCATGAAGCCACCTTTTTCGGAAATCGTGCCATTCTTACCGTG
TTTCCAACATACACCCAAATTTTTAGCACTGCTCGTGCACCCCACGACAGCACATCGTTTGCCACCCTGTTATAAAGTTGTATTGCACAGCGCATGTTCA
ACCGTTAGATCCAAAGTGCAACAAGATCAATTTCACCGAAATGCACTACAACGTACGCCGTGACCAATACAAAGTCCACGGTTCACCACGTAGCGTGTGC
AATTTTCAAACTTGCAAATGCGTGACTTCTTGACAGAAGTTTTCGGTGCCGCTGGCATCGGTACATTTGCTTCCCTGTTCTCCGTCGCGGAAACACTCGA
ACCAACCGTGAGATGAGCTGCACAAGCATCAAGATGAAGTCATCAGTCCGTGCCAAACCACGGAAGCTTCGAATCTGCAACTTTCGATTGCGCATTGCAA
CGTACCGAACGTTGCAGTAGATTGACTGTGGTCGTCGTCTGCATTGCCCCCCAAGATGAACGCGAGTGAGCTCTTGCTGACAGCATCGTCGGCGTTCATG
ATAGTTGCCAGTCGATGGCGATTGGTTTCCGAACGGGCTTCTGTCTCTAGATATGCAGCGTCGTCGGATTTCTTCATGCAGGGCGAGGGCTTGGCAGACG
CAAAGAGCAGCATCCACGGGCTGAGATAGGGACCAAAGACGGCAGTACTCGAGCGAGTGCGAGTGTATTAATAAATCCTAAGCCTGTTGTGGCAGCCGAC
CGAATGCCAGCCGATTGTTATCTGACGATGGAAACAGCTCAAGTCGCTGCTGTATGCAATGCAGAGACAAGCCTTGTGTTGAAAATGCGTCACTGATGGA
ACCACTGGTGTCGAGCCCTTGGATCAGCTATTCGAGCGCACTACGGTACGTGTCTGGCTTTTTGACGTGTACTTGGTTTTTGTATCTCGTGCAGCGAGGT
CAACGGATGGTGGCCAAAATTGACGCCATTTTGGCCAATCCAGCAGCACTGGGTACCGCTTCGAAATCTTGGCCATAGTGAATGCAAGATGTTCGGGATC
GCTCCGACTCCCGGCTCGTCTCTGGGAGAGTTACGGAGATCACAACGCCTCAGAATCGCAGCAACATGACAGGCTCTTCATCTTCATGCTGGGGTCTGCT
CTCCTTCTGTGGTCTGTAGCGACAGCGCTGGAAATCGCGAGTGCATTTCGATGCCTGTAGGGGCATTCGCTGCGAGTGACGGATTCCTGCGGTTGATTAG
AATGGAATCAGAAGGGATCCATAATCGACATAAACA