Description :
From Genome Similarity Track
Location :
contig_161:4926- 28122
Transcript NameFunction/comments
g11828.t1hypothetical protein
g11829.t1hypothetical protein
g11830.t1hypothetical protein

Sequence
23196 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGC
GACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCATAAAGTAGCCCGCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGC
TCATCATACCCAATCCACTTCACTTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATT
CGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTT
CGGTCGGTCTCCAAATTCGTTGACGGCCTTGAGTCGGGACACGTGCACCACCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCA
AACTCTTCGATCTTTTTCTTGATCCTGAATGGTCCATGCCATCGGTGGGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTC
TGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGTCAGATGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTCATCGACAT
TCGGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGA
GATTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGAT
TGTGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCC
AGTCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAG
GGTCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTCCG
AATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGA
ACAGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCTGG
CGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAATAG
TCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGCA
CCACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACGAACTTGTC
GGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCTGG
GCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCTGCTCGATTGCTCGGCTCTCAGC
TCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGGACTCGTTTCT
TCCTCGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCCACGGGCTAC
TTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTCGACCAATTCT
AATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGGACCACGTGCA
AGTACTTCACCGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCTG
GATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACTCAGCGAGGTTT
ACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCGTATCCACCGTTCTTTT
CGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGTAGGTGACCC
TTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAACTCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTACAATCGCGTTCCTTG
ACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTCGAGCGTCGAAA
AACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCGGGTGGTAGTT
CATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCG
AATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCCGGCGAAGCTTCGTTTGGCGCCGAG
AGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATAATTCAGCGCAC
CGAGGAAAGACTGCATCCCCTTTTTCGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCTGCAGAGACTTC
GTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGTCGGTCTAACGTC
TCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATATCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCATCCGGTTCTCCGG
TGGAGAATGTGGTGGAGTGGGATCGCAAAAATGGATGATGCGATCCAAACTCACCAGCGGTACGCCCGGACTGCCGACTTTCGGAGGGGGTACTCCGTTG
ATCAGGCTGATCAGAAAACCTTGTAGTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCTCTTGAAGGACGTCAAGGGTGTGACC
AAGGCGGAACTTGTTGGAGCTGAACTGCTCCTTCCGGGGAATGGGGGATGACAGCCACGCGGGTATCCTTCACGCGGTCGTCGGTTGTTGGTGATCGGGT
CTTGGGGTAAGTCGATCACGTGGGGGGTGTCCTTTGGGTGTGCTGTTATAGCCCTTTCCGTTGCTTGCCGCCTCCTCTGGCGGGGTCTTGAGTTGAGATG
AGATTGTACGATCGCCCCCTGGCCAAGCTATCCAGGTGTGCGACGTGTCCTTGGTTGACTAGGTGAGCCCTTCTTCGGGTAGGCCAATGTAGTTCCTTCC
CGGGATGTGTGGACGCCACTTGTGTCTTGCAAGGCAAATCAGAATCTATTTAAGCAAAGGTTAAAAGTCCTAAAGATCTCTCTCCCTATCCCCATCCGCT
TGCGTGCCCACCGACTGCACATCACACTTGAACTTCCATCTGTATATCTTGACCTCGTATCGGAATGACAGTAACATTGTACCTAGCATCCATCACTGTA
CCACTGTGGCGTACCATGTCGATCTGATCAGGTGAGTCCAGATGATCGCGTGTGCCCAGATGATCGCAGATGTCTGGTTGATCGCAAGTGTCCGGATGAT
CGACTGTACCGAGGGTGGTACCAGGCAGATAAAATTACCTGTACCATCATTGTGGTACCAAGTCAGGTGCTGGGCTATCCGGACATATCCGGCACCAACC
CCAACCCTTCTGGTCCAATCAGTCCAGACGCGATCTCTTCCATCATCGGCAATTTGACCCAGGTCGCTTCACCTCAATCGCCCCCTGCTCTGCGACCAGC
CGTACGGCGGTTGGTCTCAGCGCATTCCGTCGCAATTCTGCTTCTTTCTCTGAGCCACCACCATTCTCCGTGCTAGATCCAATCATGGCTGGCGCGAATG
ATACTCCACCCGAAGACCATCCCGCTGTCGCGTCTGGTACGTCCGCCGGCCGTACCTCTGAAGCTCCAGTCGTCCCCACTGCTCGTGTAGCGCTCCCTAG
CGTCGACCTTAGCGCCACCCGAGAGTCTCTGGCAGTATTCTCGTCCCTGATGGAGCGTGTTGAGGCCCAGGCGGATCTCAGCGACGATCACGCGATATTG
CAGCAGGCATACCGAGACCAGGTGGCGCGTGCTGATCGGTTTGAGGCCGATCTAAACGCCGCGTACGCGGCTGCTTCTCCCTATGTGTTGCATTGCCAGC
ACCAATATGATTTCCTATTCCGGCGTTATCAAGAAACCCGGCAGATGGCGGCCGACTTCGAGACGGCAGTGCGCGAGCGTCTCGACAATTCGCACGAGAT
CGCAGCCATGCGGGATCGTTTGCGCGTCGCAGAGGAGGTCCTCGCGGAGGAAACCACGCGATTACAAGCGGAGATTGCCGATCTAACTCGTCGTCTGGCA
GATGCAGAGTCTCCGGCGGCTAAAAGGCAGCCGCAGGGGTCAGCACGTCGTCTCGCCACATTACAGGAAGGGTTAGACCAGGCGATCGCAGATCGCGATC
GCGTCGCTTTGGATTTGGCCGAAGCCAACAAGAACCTCGGTGCGCTCGAGTCGTCGCAGCGTGCATTGGAGGACGCGACATCTCGACTGCGCGGTCAGAA
CGAGCATCTCGAGCAACGCGTATCTAATCTTCAAGCGCAGCTGGCTCAGCAAACAACTCGGGCCAAGCGGGACTTCGATCGGGTTGACGCAGAGAGGGAA
CAGTTTCGTTCTCGTGCAGAGGCCGCTGAGGCCACTCTCCAGACCACGTCCAAGAACCTGCGGCGGGTTATGGCCGATCGCGATCGAGCGTTAGCTGACC
GCCGATCAACTCGTAAGTCCGCCTCGCATCCGATAAATCTTTCGTGCGTGACACTAACATTGTTCCTCTATGTATTGTACCAGAGATCCAAGTTGATAAC
GCGCGGGCTTCAATCGCGCGATTGGAGCATGGCCTGAAGGCTTCGCAGGCAGATCGCAGCCGCATCAAGGCGCTCAATCACGAGAATGAGTTGCTCCTTG
CTGACTTGGCCAACGCGCAGTCTGCGTCTTCTGCTCTCAAGAAGGCTTGTGATCGTGCTGTACAGGACCGTGATCAGCTCCGTCATAGGGTGGCGGGGTT
GATCTCGTTCATCCAACCCGCGCAAGACGAAACGCCACTTTCTTCCTCTTCCAAGTCGACGCCTGCCGCATCCAAGAAAACGGCCAAGCGACCGCGCGGT
AGTTCTTCGGCTGGCAGCTCAAGTCCGCCCCGTAGTCGTCCGCGACAGCGATCCCCTAAACCAGTGTCGGAATCAAGTACTGTTCCGCCTTCTCACGGTG
GATCTGCTTCGCGATCTCTTTTCCTTTCGGGACCGTCAACTCCTAACTCCGGCAGGCTCTCTGGTGGCGATCACTCTCCATCTCAGCGGTCACCATCGGT
TAACGCCTCCCCGACCAGTAGTGACGACGATTCTCTGTTGGCGGCTCTCGCAAGTTCGCGATCGTCCGGTCGTCGCCGTTCGTCTTCCACCGGCAGCCTT
AGCGGTCGATCATCCAGCCGCCCCATCGACATCGAGTCATCCAGTTCTTCGGAGGCTTCGAACCAGGATCCTGATCAACTCGAAGAGTTGGAGGACGACC
CTGGCAGTGCCTCTTCCGGTGACGAGAGTGATGGTGGTGCGGACAGTCATTCGACTGCGCCACGTGATTCCGATCGTGGCAACGAGAACGACGGTGACAG
TGACGGAAGCGTAGCTGATGAACCGCGGGCGCACCGCAATCACCTACTCACGCAGGTCGCCCTGGATCAGCTTGCTCGTCCCACCGTTCCCCGTGCTGTC
TGGATCCCTGGATATCGCGCTCGTTCTCGTAGGGCGGCAGCGGACGTTCGCCCGTGGTCGGCGAGCACTTTGAGCCGGGTCAGTGTCTTGGAGATGGACA
TCGAGTTGCTCTTTCACCACATGGCAAAGCCTAAAAACTGGCTTTTTCCGCCGCAGAGTCGATCGCCTCGTCGCGGCGCTTGGTCACCCGGTCTGATCAC
CGAAAGCAACATTGCGGCACTTTATGCGACGACGCCGTGGAATTCTCTCAACGTCTTGGTGACGCCTTTATCTTTTGAGGTGATTGGTTGGTTCGAGGCG
ATGTCTCGGAAGTATCTGGAAATTGAAGATGATCACCGGCAGGCTCTATGGGAGGCTACGCACGCGTTCATGATCAGCTCCACGCTTCGTAAATCGAACA
CATATCTGGCACGTCTTTGGGAAGATCGCAAGCAGAGACGATCACGTTTCGGTGCCGTCTGGAAACGCTTCCTCAAGTTGATTTTGCAAGGGATGATTGC
AGGGCACTGCGACTTGGATATTCTGCTGGACCCTTTCTTTCTGCATTATCCCCGGGCGCACGAACAACGAGTTTGGTACCCTGGGCTTGATTGTGGTTCT
CCGCCATCCAACCTGGTGGACGTCCTACGTGCCGTCGATCTGGTTGACCCGTGGCGCAATCAGTATCGCGGCCACCTTCAAGATCATCCGGGCTCCCAAC
TGCCTCGCCTCACCGGTAAATTCTCTCTTGTCGCCGACTAAGATGAGGTAGTTAGTGGATCGTATGTCTTCTCAATATGGTCCCCACGGCTTCTCCCTTC
GTTGTTTTTCTTCATCATTTTCTTGCTTTATCGAGCATCCCGCTCTGATCGAGAACAGCCGTCCCCGATCTACACAACAATACCACATAGAACCCTTCCA
CCTCAATGTGCGACCACCTCGCACACTGTTCACACCACTCCTCCGCCCGCAACAGCCAGCTTGCTACGAGATCTCCTCCTCCACCTCGTGCGACTGCATC
ACAGTGAAGCGATTCCGGTTGACGACTCCTCGCTCGTACTCGCGTAACAAGGCTCCGCAATTCAGATCGGCTTCATCAACCCACGAAAGCTGATCGTAAC
CCTTCCAGCGCACCTGAAATTCCCGGTGGACGCGACCATATCGCGTTCGTCGGCCTGATCGCATATTCACGATCTTTTCCACCTCGAACTCGTCCTCATC
GAGACCGGCTTCCCAGCTGTCCTCGGGTAAAAGCGCCTCATCAAAGTTGAAGCGATCTTCTTCGTCCACCACCAGCGTCAGCGTGGAGCGATCAGGGAAC
GATCGCACAGGCTTGAGTTTTGACACATGGACGATCGGGAATAACCGATAGTTGGTGCCAGCGACTTCCAACCTTGCTGCATGATTGTCAAGCATCTCGA
TCACTCTGAACGGTCCGTGCCACATGTGGGCTAACTTGCGCGCATAGCCCTCCTTCACGCGATCTAGGTACAGCCACACTTGCATATTGGCCTCAATCCC
ATGAGGTCGGACCTGATCATTATGCCCGTCTGCTCGTCCTTGAATGGCCTCCCGCAGGGACTCGTTAACCTCTTCTCTGGCTCGACGATAGTGGCTCTGT
ATATGATATCTCCACCGACGCGGGTCACGATCCCGTCGGCGCGTGCTTCCGAGAGGTAGCGACGCCTCTAACGTAGATCGCGGGTCCCACCCGTGTATCA
AGTAGAACGGCGTGTCTCCTCGAACCCGATCTTGGGCCGTGTTGAGCGCGAACGTCAGTCGCTCGGCGTACTCATCCCAGTCCTGTTGGTTGACGTCTGC
GACATACATCTTCAGCGCGCGTGTCAACGTTCGCACCATCCGTTCTGCCGTCACATTGGTCTGCGGTCGATAAGCCATAGTGGCCCTCTGTTTCTGTCCC
ACTATCCTGCTAAAAGCACGGAAAAAATCAGACATGAACCCAGGTTCCCTGTCATGCCGGATAGCCTCACTGGCTCCAAAACGCCGGAAGACGCATTCCT
CGTAGTTCTCCGCAATCGTCTGCGCTGTTCTTGACGCGCTTGCTTTAGCGATCACATAACCCGAGAACAGATCTACCCAGATCAACAGCTCCGTATTGCC
TTTGAAGGACTTGTGGTGAAGTGGATGTTGGAAATTTCGTGATGGACCAACGATGGGCTAGGATCGGACGGGACCGGACGTACGATCGGAGGTTGATGAA
GGCAGACTTTGGAGGATTAAATTGGACCTGAGGGGTAGGGGTATGAAGACCCAATGGGTACAGTGGCGCCATCAGTCATCGGTGTATACCGGTATGCGGT
ATGGTGCGATCATTTCGATATGCGATCGTGGCCACCACCGCGATCGCGATCCCGATCGCAGATGGCGATCGTGACGTACCACTTTGGTGGTACACCCGCA
ATCATTCCGGAAGTAAAAGATCTGTGGAAGGTACCTCGGGAGATGGGTGAAAGAATCCAGTAAAGGGGGGAGGTAGGAAGCTGAGGTCATTGTTGCTTTT
TGCTTGTTAGTTTTACCTAATAAGAGAAGAAGAAGCTTTCCCTTGCAACACAAGTGGCGTTCGTTTATTCCAGGTTGGGAAGTATATTGGCCCTCCTGAC
GACTTCGGACTCACCTCGTCGCGCAAGGTAATCACACGGGAGCCCCTGGATCGCTGGCCAGGTGTGCAACCACATAACCCCCCCCCCAGAAGACCCGCCA
TAGGAGGCGGCAAGCACGTAAAGGAACACACCCAAGGACACCCCCCACGCCGATCAAGCCCCACCAGGCCCCGATCGGCAGACGACCGACGACCGCGTGA
AGAATACCCGCGTGGCCGTCAACCCCCAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCATCCTGGTAACCACCGACGCCTTCAGTGAACACCGGAA
GAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCGCGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGCAGTCCGGGCG
TACCGCTGGTGAGTTTGGATCGCATCATCCATTTTTGCGATCCCACTCCACCACAATGGTGCGCGTGCCCGGATCTTCTGGTGATTCACAGGGATTTCAC
CGTGAGTCCACAGAAGAAGACGTCAAAATCAAGATGGAACCAGGGAACGAGTCGTCGACGGAAGAAGGATCGCCGCCGACGGCGCTGAAAGCGCCAGGAT
CCACTGATCGTGAGAGTGCCGGAGGAGCTCTGACGATGTGAAAGAGGAAGGTTCAGCGATGGACCTAGAAGAAAAGCCTCAAACCCCTCCCCAGGTCCCC
TCGGGGACCCCCGCGGATCGCGATGCGAATCGTGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCAAAACCACTCCTCCAGTTC
CGCACGCAACCTCGAAGAAGAAGAAGGCGAAGACCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGATCGCAACACGTGGAC
GGACGAGCAACTGGAGTCTGCCTTCTTCTACACGGACCTGTACAAGTTCCTGCACGAAGATCCTGTAATGAAGATCGTGCGCCCGAAGCCAATTGGGGAA
CTGCAAGGTCCAGTGAAGGCACCGAAGGAAGTAACCAGCCAACTCGAGGCGGTGAAACTGCTGATGCGCATGCTGAAAGAAGCGGGAATCGTGCTCGGCT
CCTTCGACGCGAACGAGCTATTCGACTGGAATTGCCAATCATCAGGGAATCAACGCTGAGCCTGTTCGCGAAGCTGACGCCCCTTGTCGGTAGTGTCGTC
CCGGTTCAACGTGAAAGACCAACACCGACTCGCAGCCAAACCGGATCGTCGCAATATGCCTCAGCCACATCCGAAGCGGGATCGGACAGCTCGATCGAGC
TGCAGCGGATGACACTTGGGCCGGCCGGAGCAGCCATGCTACAGTCGCGAAAGGAGAGATCGGAAACCAAGCCGACAGTGATCGCGACGAGCGATCCAGC
CCAAGCTCCCCTGAACGCATGCAATCGTTCTTCAATGCAGCAATGGAGCGTTTCCTGAAGGAACAGCAAGCGGTCTCGACCACGCCAGTCGTCAACCAAA
CCAAGCCACCTGGAGCTCAAGACGTTGACATGGAGTCCGTGGAGTCGAATCGCCGGGACCATTCGCACCCGAGCGAATACGATCCGGATGACCTGGGTGT
CGACGTTACCCCTCGTGCCGCAGTCGCATCTGCTGGGACTACAGGCGGCGGAACACTCTCAGCCACAAGGATCCGAGTCTCCGCGATCTCAGAACTGAAG
GAATTTCGGGAAGGACAACGACGAAGATCGTGCCAGAAGCTGGTTCGGCAAACTGAAGTCTGCCTTTGTCCGCGATCAAGCTCCTGACGGCGAGAAGTGT
CTGGTGTTTGGAGATCTGCTCACTGGACCCGCACGTAACTGGTACCGACAGCTGAGTCGAACGACGCGCGGCAACTGGAAGAGCTTGTCTAAGAACTTCC
AGACTCAATACTGCGGACGTGGCGTGTCTGTCGCGAGACAATACTACCATACGCGAAAGCGATCGGATGAATCGCCGCTGGAATATCTGCACCGTCTGAA
TATCGCCGGTCTGCGAGCTCAGCTCTCGATCAAGGATGGATCGATTGAGGTCCGCCGTGAACATGGCGATCACTTCATCGAAACACTCGACGATCGCGAT
CTAGCCAGCCAACTGGCACTGCTAAGAATTCCGGACGCAGACACTCTCGAAGAGACACTGCGATCCCGACAACGTGCGAAGGCGAGACAAGGAAAGACGG
TGTATGGGTCCATCAAACCCAAGCAGAAATCACCCACGGGGATCACCCCATCCGCGAATGCTCGCGCAGTCCGCGCAATCCGCGCAACGGTCAACTCGAG
CGACTCCGAATTGGAAACCAGCGGATCGGAGAGAGAAGGAGGCCTACGCAAGGTGTACTTCGCGGCAACGCCCGATCAGCCGACCAGATCGCATTCGGAT
CAGGAGCAACGCCGTCCTAGTCGAGACTCCAACGACCGTCGCCTCGATCGTCCAGCCGGATCTCTCGAGGGAGAAGCCCCGCGGAAGCCATGTTCCCACT
GTGGATCGTCGAAGCACACCGATCTTGGTTGCTGGAAGCGTCTGACGTGCGAGAAATGTGGCAAGAAGGTCCACCCGACCGATCGCTGTCTCTTCGTCTG
CAAGGCCTGCGGCGAGATTCACGGAGCCGGAGAGTGCCCGATGGAAGAGTTCTACAACTTGATCCGTCAATGGTACAACCCCACCAAGCACGGTGGAATG
CTCCCGCAAGCGGCTGAAAAGATGTTAAACTAGAACGCTCGCCGGGTTTGAATCCGGTACGAGACGAGCGTTCTCAGTTCTGCATCTATGCATATGTCGA
AAAACAGTCGAAGTCAGAGGTGAGTAAGCTGATTCGGCCGACGGACAATACATGTGACCTTCATGACAAACGTACCATGGCGATCTCCAGCCTCCACCAA
GTCGACGAGTATTCGCGATCAGAAGTGACGATGGCTCTGGATCTCCTGCACGGAGAGTCGCGAGGATATTGGAAGTACCATGTGCCAGACAAGAAATTCC
GGCAGGCGAAAGCCATGGGGAAGATCAACAACGAAAGAGCCACATTGCTGTTTGACAGCGGCGCCGAGGTGTCCATTCTGGATGCCGCCTTTGCTCGTAA
GGTTGGGTGCTACATAGACAACAGTCAAGAGTTGGAATGTGAAGGAGTTGGTAAGAATCCCTATATGGCGGATGGGCGTACCAGAATCAAGATCACGCTC
GCTGGATCACTGGTGTACTACTTCGACGCGTGGGTTGGTCCGCCCACAGGTGGCCAAGACTTGATCCTGGGGATGGACTTCATGGTGCCAGCTGGCATCC
GCCTCGATCTGGCTGATGGATCAATAAATCTTCCAGACGAAGTGCGTATTCAGCTAGCCGGCCGACGTCAACTCTACGGAGAGAAGATCACGCAGGTCAA
GCTGGGAGAACATTGCCAGTTGGAAGTCGGAGAGTCGATCGAGATTCGGAAGGGTTTCATCTTGTCGAACCACCGGAAACTGTGGGTTACTCGAGGAGAT
AGATGGGTACCGAGTCTGGTGACAGGGTTGGGGAAAACTCGCTATCTGAAGATCACGAATATCAGCGATCAGAAGTTAGTATTGCAAGACGACACCCATG
TCGGCATGTGGCTTGAAGGAGGACGCGTACCTCGCACTCCCGGTTTCGTGTTACTTGGATCGCGCAGGTATGCCGAGTGGCAGAATCTAGCTTTCCAGTC
TACTACAGACCGTGTGGAGGTAGAAGAGCATGAACTCGCTCCTACCGGACCCATGGTAGATCGACCTCAGTACGACACACCGATGAAAATCCTGCGTCGT
GACCGCGGAACCTCGAGATCGGTCGTCGCACAACTAACCGTGCCTCGACCCGCCGAGATGAAACCAGAAACAGAGGGGTCTCCAAGGGATCAGGAAGGTG
GCACCGGCGATCAGGACGCGATAGAATCTCCGCCAATGGAGCAGGCCACACGAAACGAGATGACTGCGGACCAGAAGGAGTCTATGCCCCAGGCCGAAAC
GCCTCCGATCGTTGATCCGGAACCGCTGGATGACGAAGAAGTATGTTACCACGAAGGTGGCGACCTGTTCGCGGAAGATGTGGAGAGACAGATGGCAATC
TTGCCGGAAGTAGTGACCACCACCGAGGAAGTCACGATCGAGGATATCCAGGTGGGCGATCCTGAGTCAAACACCCCGGAAGAAATCGATCGCCTGCGGC
AGATAATTTGGAGGCGGAAACATCTCCTGATCGGGAAGGGGAACGCATTACCACCAGCTGCCGTTGGCGCAGTCTGCGACATCGATGTGGGAGGAGCAGC
TCCTGTTGCACAACGTGTCCGAAAAGTCGCTCCACAGTTCCGTGAGAAGCTGTCGGATCTGATCAAGAGCCTGTTATCGGCGAAGATGATCACGCCGTCA
ACTTCACCGTGGGCCTCTCCGATCGTAATCATCATCAAGAAGAACGGCGTTGACATCCGGCTCTGTATCGACTACAGGCTGGTGAATAGTTTGACGAGAC
TGATGGTGTACCCCATGCCGCTGATTAGCGATCTCTTGGAAGACTTGGACAAACTGCTCTGGTATTGCTCACTCGATATGGCAAGTGGCTTCTGGGTAGT
CTCCATGACAGAACGCGCACGAAAGATCTCTGCGTTCATCACACCGTTCGGGTTGTTCGAGTGGACGCGTATGCCTTTCGGGTTGAAGAATGCGCCACAG
ATCTACCAGCGATTGATTGATAACGCGCTGTATGGACACTTCCGAATCCGCGCCGGTCACGATCCGTCGAAACCGATCGACGTGTTCGATTCAGGCGAGC
CAGAACCAGAGCCGAGACCGTCAGTGTTGGGAAGGCGATCGTACATCGATGATATTCTGGTGACTGCGATCACTTGGGACATGCTGTGTGAGAAGGTTGA
AGCACTGCTCGATGCTTGCGAACGATGGAATTTGTCCATCAGTGTGGTCAAAAGTTTCTGGGGCCGACGAAAAGTGGACTACTTGGGACACCGAGTGTCC
GTCGACGGTTTGGAAGCCCATCCGAAAGATCTTGAAGTGTTAGGTAACCTTCCCTTCCCGCAGACTCTGCGATCGATGCAGTCCTTCCTTGGAAGTTTGA
ACTACTACAGTCGGTTCATCGAAGACTTCGCGGTCTACGCCGCTGTCCTGTACGAGCTGCGCGAAGCGGATTTCCACGAGATGGTTCAGCAGAATAGGTC
CATCCCCGGCGAACAAGTAGCTGGGGGCGTTGTCACGCGAGCAGAAGACGCTGACCGCTGGGCCCGAGCGAAGATCGCGTTCACGATGCTGAAAGCCAGG
ATCGTGTCCACCCCGATCCTGAAGCATTTCGACGCAGATCGCACTCCAGTGATCGTAGTTTACGCGAGCCAGTGGGCGATCTCCGCGGCTCTTGTACAAG
AGCATGATGGCGTGTACTGGCCAGTAACCTTCACCAGTCGTACTCTGAAGCCCAACGAGATCAACTACGGGATCGTCGACAAGGGAGTTTTGGCACTCCT
GCGGATGCTAGACGTGAATTACACACTGTTGGCGACGAGGTCGATCTTGGTGCTGTCCAGACATTCGACGCTGGCGTGGCTGGTCAACTCGGCTGGCTTC
CAGGGGAGACTGGGTAATTGGGCAGCTTTGTTGTCAGAATGGACGTTAGAGATCAGGAAGTGCACGAAAGGGGAGGATGAGATTCTGGGAGCGATGGCAG
CAAGCATCACACCTCGCGCAGAAGTAGACGAGGCGTTGATCGCGATTGCCCCAGTAAAGCAGCCCCGACAGACGATCACCATGCCACCCCCTACGGTCGA
AGCGGATGAAGCCTTGCTGGTCGCGAGTTTCGACGGATCAGCGCGTGTCAAACGCAGTGGTGGCGCTTATAGCGCGATCGTGTGGAGGCTGCCGGGATGG
ACGATCGTCACCGCCGCATCGGAGTATGTGCCCGATCTGACTGTGAACGAGGCGGAGTACCGCGGGTTGTTGTTATGTTTCGATCTGCTGTCCACGATGG
ACAGGGGGCAGATTGGCGACTCCAATTTAGTTATCCGGCAAATGCGTGGTGAGATCGCATGCAAGGCCCCTGGCCTGTTGTTGTTGCGCGAGAAAGCGAT
GGATCGGCTCAGGTCGTGGCCAGAGCACGAGTTCCTACACATGAAACGAGATTGGAACCAGAGTGCAGACAAGTTAGCCAGTGAAGCTCTCCAACGGGCG
AAGGGATCGTAGTCACCTCAGACGAAGATCAACAAGACTTGATCACGCTCAACCGTTTGGACGAGCTCCTCAAGATGAGGGACGACGATGCCGTCGTCCG
TGTGTCTGCTGTGACCAGATCGACGCGACGCAGACGACTGACTCCTGAAGTCCTGCAAGAAGCGATTATACAGCGTATACGCGGTGAGCGAATCATCCAA
GCACAGAATGAAGAGAAGTGGATCATCGATCTGAAAGCGTACCTGAAAGGGAACGTCGAGGCTCTCACCGCGGCCGAAGCTAAATCGTGTGCCAGGGTCG
CGAACGATTACGAGTTGGACGAAAACGATCTGCTGTTCTATTGCCCGTCAGCCATGCGGCAGGAAGAGGGCCGAGACGAGATCGCGAAGCTGGTGGTGCC
TGAGACCCTGCAACAAGATTTCCTACATCATTACCACGCAAGTCTGGAAGGGGGACATCAAGGGATCGGAAGGACGTACCGACGAATCCGATCACACTTC
CACTGGAGGGGCTTATACCGAAGTGTCCAGCGCTATGTGGGAGAATGTACAGATTGTGAGACAGGGAAAGGCCGACCCTTCGTGAGAGGAGAATCCCCTG
GGAACGTGCAAGCGACGTACCCGTTTCAGATCATCGCTATGGATCACATTCCGTCGTTGCCTAAGTCTGTGGTGAAGCGGGATCACGAAAATTGCTGTCG
TGATCTCCGGCTTACCAGCGGTACGCCCGGACTGCCGACTATCGGAGGGGGTACTCCGTTGATCTGGCGCGATCGGAACCTTGTATTCACCTTGTGTACC
CGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCACTGAAGGCGTCGGTGGTTACCAGGATGGGGTGGGGAGCTGGACGGCTCCTTCCGGGGAACTGGGG
GTGACGGCCACGCGGGTATTCTTCACGCGGTCGTCGGTCGTCTGCCGATCGGGGCCTGGTGGGGCTTGATCGGCGTGGGGGGTGTCCTTGGGTGTGTTCC
TTTACGTGCTTGCCGCCTCCTATGGCGGGGTCTTCTGGGGGGGGGTTAAGTGGTTGCGCACCTGGCCAAGCGATCCAGGGGCTCCCGTGTGATTACCTTG
CGCGACGAGGTGAGTCCGAAGTCGTCAGGAGGGCCAATATACTTCCCACCTGGAATAAACGAACGCCACTTGTGTTGCAAGGGAAAGCTTCTTCTTCTCT
TATTAGGTAAAACAACAAGCAAAAGCAACAATGACCTCAGCTTCCTACCTCCCCCTTTACTGGATTCTTTCACCCATCTCCCGAGGTACCTTCCACAGAT
CTTTTACTCCGGAATGATTGCGGGTGTACCACCAAAGTGGTACGTCACGATCGCCATTTGCGATCGGGATCGCGATCGCAGTGGTGGCCGATCGCATATC
GAAATGATCGCACCATACCGCATACCGGTATACACCGATGACTGATGGCGCCACTGTACCCATTGGGTCTCCATACCCCTACCCCTCAGGTCCAATTTAA
TCCCTCCAAAGTCTGCCTTCATCAACCTCCGATCGTACGTCCGGTCCCGTCCGATCCTAGCCCATCGTTGGTCCATCACGAAATTTCCAACATCCACTTC
ACCACAATCGCCCCCTGTACATGCCGGGGCTGCCCAACAGTCTTGGCGTGCACACTCGTCACTTCTTCTTATCGCTCCTCGCCACCACACCTCCACAGCA
CCATGTCGGACAACTCTTCGCCGGATCAGGGGCGTTCCCCGAACGATCCTTCTTCCCACTCGCCTACGCCCGCCTCTCCCGATCTCCTTCATCGCCGCAG
AGGGCTACGACCTCGAATTCGTCCCGCTGTTCCTGTGGCTTCCGATGCCACCGTCACAACTCCTGCAGCTTTCTCCGAACATGTACGCCGAATCGAAGGT
CAACCTGGCGATCTCTCGACCGAGTCGTTGCCTCAAGCTGGTTCCTCGTTGCCGCCCTTAGACCAGATCACCATCCGGAGATCGTTGGCTGCAGTTGAAG
CCGCTCTGGATCGCGAGAGTGAGTTTCAGGCACTCCAGCGCAGCTACAACGACTTGTTGCAGTCCTACTTCGCCTTGCGACAACGTGTGGCAGACCTGGA
GCACACAATTCGTTCGGCAGCTCAGTCGGCGTCCCCATTCGTCTGCTTCGTCCAACAGAAGTACGATCAGCTGTCCCATCGTCTCGCGCAGTCTATCCTG
GACTTAGCGGAAACCCGAGAAGCTCTGGCCCGGAGACTCGACAATGCAACCGAGCTCACCAACCTCCGTGATCGTATGCGCCTCCAAGATCAGTACACGC
GGAAGCCGTCGCTGACTTCCAAAGGGAAATCGATGATTTGGAGCGGCGTCTAACGGCTGCATTGGCAGTTGCCAGCACGACTTCTGGTGACACAGCTCTG
CCTCCGTCTGGGGTCAACCCGACCACCCTTCAACTCCAATCCCAGCTGAACGTGGCGATCGCAGCCCAAGGTCTAGCGAACCGCGATCTGGATCAGGCCC
GCGACTCAATTCGCGATCTCGAGACCTCCCAGAAGGCTCTCGAGGGATCGGCGCAGATCCTCCGGCAACAGGTGGCGCTACTCGAGCGTCGTGCGTCCGA
ATTGCGCGACCAGTTGGCGCAACCCGACACGGTTCCCGGCGTGCCCTCGACCAGAGTCTTCAGGAACGACAACGGCTGCAGGACCTACTGGACAAGTCCG
ACCAAGATCTAAGCGATCAAGCGGCGAAACTACAACGGGTGACCCAAGAACGTGATCGCGCTCGGAACGAGCTTTCACAAGCACGTACGTAATCGCGTCG
ATCCTTCAGCGTCCGTTGATCTAATCCCGTTTCTCTTTCTTGCAGGTAACCAAGTCACATCCGCCCGCCTTTCCATAGCTCGGCTGGAGCAGCGAGCAAG
CAGCCTCCAGTCTTCGGTAGCCGCCAACCACCAGCTGAGCAGCACTAATGCCGTGTTGCGTGCTGACCTCGCGACCGCCCGTCAATCCCAACAAGATCTG
GAGAGCGTGCGTGATCAGCTGATCACAGAGCGAGACGGTGCTTTGCGGCGCCTTTCGGACATCACCAGCATACTTCAACCTGGCTCGATCGTTCCTCCGG
CGACTCCTGTTCCCACGCCAGCCAGCGATCCCTCCCTGCTGAAAAAGTTCCATCACGGAAACGTCTCGCCAGCCGCTCTCCTTCCCGTCGCTCTCCATCA
AGTCCGTCGTCTCGTCGCAAGCGGCCTCACAAGTCTCGACGTCGCCGATCTCCTTCATCCGGCGACAGCGACGATGATGACGCTCTGAACGCCGGTCTCG
CTCGATCGCGTTCTCTGGTAGACGATCACATTTGTCCCGATCGAAGCGTCGCGCAGCAGGTACCCCAGCAAGCCGATCAACGTCGACTCTTCTAGCGATC
GTGGATCGGATGGCCAAGCCAGCGACGACGGCAATAACGACGATGGCGGTAACGCCGGTGACGATGACCGCGATAACGACGATGGCGGTAACGCCGGTGA
CGGCGACCACAATGACGACGATGACGGTAACGACGGCGACGGCGACCGCAATGATGACGGTAACGACGGCGATAACAAAGACAGCGACCACGAGGGCGAC
AACGACGATGACGGCGGCGGTGACGGCGGCGGTGATGGCGGTGACTCGTCCGGAGGCAGCTCCGCCGGCGACCACCACTCGGGCGATTCCGATAGCAGCG
ATTCAGCGAACTCTGTCTTGTCCGATGCCGAGCTCGATCAGCTCGATCCCACCACCATCTCTCGGGACCGTTGGATCCCAGGGTACCGGAGTCCTGTAAG
GTTCGCGGGTACGGACGTGGACCCTTGGCCTCTTTCTCCGGTTCGTCAACTCAGCGTCCGCCATTTGACGGTCGCCACGTTATTTCGTCAGTGGAGTCGT
CCGCCATCTTGGCTATTCCCGCGTCGGACCCGCACTCCTTCTGCTGGCACCTGGAATCCCGACTTGATCACCCAGGCTAATATCTTGGCGTTGTATAAAC
TGCGACCATGGATTGTGTTGGGTCGGGCAGTTCCGCCGCGATCGTTTGATGCGACAGGATGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGA
GGAGTTTCGTCAAGCATTCTGGGAGTCTACCCACAAGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTTGGCTCGGGTGC
AAACAGCGTCGATCTCGCGCTGGTCCCCGGTGGCAGACCATCCTCAAGCATCTACTGGCTGGGATGATCGCTGGACACTGCGATCTCGACCTGCTTCTGG
ATCCCTTCTTCCTTCATTTTCCGCGCCAAAACGAACGGTGCTTTTGGTACCCCGGTTTCGGAGCCACGCGGGCGCCTCCTGACTTAATCAACGCTCTTCC
TACCGCCGATTCTGCCGACCCGTGGCGCAACCAATATCGCACACAACTGAGCGATCATCCCGGGTCCCGCATCGCACGCCTAGACGGTAAGTTTCGGTCC
ATCGTCGATTCTGAGTGAAGTAACCCTCTCCAAGGTCTTGATAAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGGTCACCCGACCC
CGATCGGCCTCTTCCTTCCCCGATCGCAAACTCACAAATCACAAATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATTCTCCTCCTCCC
CTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTTCCCCTTCATGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTCCTCGTTCAAAGTCGCGC
AACATAGCGCCGCAATTAAGGTCCGCCTCATCGACCCAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGTGGACTCGTCCGTAGCGCGT
CCGGCGGCCGGTTCTTACATCCGCGATCTTCTCCACTTCAAACTCGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCCTCCGGCAGGAGGGCTCATCGAAAT
CCAGGCGATCGCTCTCGGCCACAAGCAACGGCGCGTCAGGACGATCGGGAAACCTCCGGACCAACTTCAATTTGGACACATGCACGATCGGGAAGATCCT
ATACTCCGAACCCGCGATCTCAAGACGTGCGGCGTGATCGTCGATCATCTCGGCGACACGAAAAGGTCCATGCCACAGGTGTGCGAGCTTCCGTGCATAC
CCCTCCTTGACTCGATCGAGGTGTAGCCATACCTGAGCGCCCACCGCGATGTTGTGGGGCCGCAGATCTTCGTTGTGTCGGTTGGCTCTGCCTCTGATCG
CCTCGCGCAGTCGCTCGCGAACCTGTTCCCGCGCTCGCTGGTAGTGTTCTTGTACGTGGTACCTCCATCGACGGGGCTCCTGATCGCGTCGGCGCGTGCT
GCCTAACGGTAGCGCTGCCTCCAGTGTCGATCGCGGGTCCCACCCATGGGCCAGTAGAATGGCGTGTCGCCACGAACTCGATCCTGGGCCGTGTTTAGAG
CGAACGTGAGTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGTTCACGTCTGACACGTACATCTTCAGCGATCGCGTAGAGTCTGCACCATTCGTTCGGCA
GTTCCGTTGGCTTGCGGCCGGTACGCCATCGTAGCTCTCTGTTTCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTC
GATCATGGCGGATGACCTCACTGGCGCCGAAACGTCGAAAGACGCATTCTTCGTAATTCTCGGCAATCGTTTGGGCAGTGCGAGAGGCGCTAGCCTTCGC
GATCACGTATCCGGTGAAAAGGTCAACCCAGATTAACAGCTCTGTGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGTCCATGGCGATCATTTGG
AATGGGTACGTAGCTTGTACATTCCCTGGCGATTCTCCCTGAATGAGGGGGCGCCCTTTCCCAGTTTCACAATCCACACATTCTCCCACGAACCGCTGAA
CACTCCTGAACAGCCCTCTCCAGTGGAAGTGCGCCTTGACGCGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGGTAATGATG
CAGGACGTCTTGTTGTAGCGTCTCCGGGATGACCAGCCGCGCGAGGGAGTCTCGGTCTTCGTCCGATTGCGGTTTTGTCGGGCAGTACAGCAGGAGTCCG
CTCTCGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTTAGCATCGTTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATGTTCG
CGATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTCTCGGCACTCGTCTCGACCGTCG
TGCCGATCGCGTCACCGCTGATACACGAGCTACAGCGTTATTATCCTTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGATCAGGTCCTGTCGATCA
GCTTCCGAGGTAACTACGGTTCCTTCGCCTCGTTGAAGAGCTTCGCTAGCTAACTTGTCCGCACTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGT
GTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAA
ATTGGAGTCACCGCAGATCACGACCCGCCCCCTGTCCATAGTGGACAGGAGATCGAAACACAACACAGTCCGCGGTATTCAGCTTCGTTCACCGTCAGAT
CAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCCCGGCAGCTTCCACACGATCGCGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCC
GTCGAAACTCGCGACCAGCAAGGCTTCATCCGCTTCGACCGTAGGGGGTGGCATGGTGATCGTCTGTCGGGGCTGCTTCACTGGGGCAATCGCGATCAAC
GCCTCGTCTACTTCTGCGCGAGGTGTGATGCTTGCTGCGATCGCTCCCAGAATCTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTG
ACAACAAAGCTGCCCAATTACCCAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAGCCACGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGACCTCGT
CGCCAACAGTGTGTAATTCACGTCTAGCATCCGCAGGAGTGCCAAGACTTCCTTGTCGACAATCCCGTAGTTGATCTCGTTGGGCTTCAGAGTACGACTG
GTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGGTGCGATCTG
GATCGAAATGTTTCAGTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATTTTCGCTCGGGCCCAACGGTCAGCATCTTCTGCTCGCGT
GACAACGCCCCCAGCTACTTGTTCGCCGGGGATGGACCTGTTCTGCTGAACCATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGGACAGCGGCGTAG
ACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTT
CAAGATCTTTCGGATGGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCACTTTTCGTCGGCCCCAGAAACTTTTGACCACACTGAT