Description :
From Genome Similarity Track
Location :
scaffold_66:49253- 55036
Transcript NameFunction/comments
Pl_110634hypothetical protein PHYSODRAFT_310116
Pl_110635hypothetical protein PITG_02637

Sequence
5783 bases(100 bases per row)
ATGACAAACCAATTTCTAATGTCATAGACACAGCCAATTTTCACGCTCCATACCCGATATGGATGTTAAACCCCAACTCATCGGAAGACATTCGTGTGTT
TCGGACAGTTATGGATATCCGGGTAGACGCAACCGATGTCCAGTAAGTCTACATACCACTCCGTTCATCCTTACCTCTTGGTCACATTATGGTTCCCGCA
CAGATACGTCCCTGAATGGCCAGAGATTGTGAAACGCGCTTGGATCCAGGTGAGTCTTCGACAATAAAGACGGTTGTTGTTTTTTCAGCATTCAATTCTC
ACATATCGTCCCAAACGTACTATTCGCCAGTACTACTGCATCTTTGTGGTCGTCTCAACCTTTGCAATTGCTCTACGCGAATATCTCTTCATCTCCAAGG
TTCGTCGACATTTCCTTGATATTATCCTTTCAAGTTACTCACTATCTACTCATTTTCCTCAAACCTCAGATCCTACCCAGCGTATGTGTCGTGGACGAGT
CCAGACAGACCAAGTACGAATAGGTTATGATGCATGTCAACTGTACCATGTTAACGTCAGTCATTTCAGTTAAGATTTCAATTTCATATCGGTTAAAAAG
GTTAAATACGTAGTACCGTAGTTCAAGTTTCACGTCAAACAACAATCATGACGAAGGAGAAGGAGCTCAAGACAGAGGAAGAAGTGGATCTAGACGACCT
CCTAGATGGTAAATGCCTGCACCTCCATCTAATACATATGAACTCCTTCTCTGACTATCTGTATGCTATGTTAGATGCGCTGGACGACTTCGCGGACGAG
CTGAAGGCCTCGGAGATCTCGAATGTGAAACAGGAGGCGGCCGTCACTACCGCTGCGACGCAGGAGAACGAAGATAACAAGTTGCAAGAGGTTCGAGAAG
CTGTTAAGAACCTGAAAAGGAGAAAATGATAGTCTCTCACGGTGTTTTATACCAGAATATGGCCAAGTTCCTTGAGGACGCACAGAATCCAGAGTTCCAG
AAGGTGCTGGAGCAGGCATTCCGCGAGCTTGGCACAGACGGTATAGTGAGATCAAGTGAAGACGGAGTTGGAGAAGAGATTGACGTTTGTTGGTGCGTGT
AGCGGACGCGGAGAACATCGACCAGTTGCTGGGATCGTTGAAGACAGATGACTCGATGCCGGATGAGACAGACGATGTCAACGCTGGGGTGGCCAAGACA
CTGCAGAATATGGCAAAGGCAGCAGAAGATATGGAAGGTGTAGGTACGGCACAAGTGGAGGCAATGGGTGAAGAGATGATGGCGGAGATGATGAGGAAGT
TTGAGGAAATGGGCGAGAAGGTGCTGTGACTGAGGGAGATGTCGTTATGGAGCATTGAGGTGCTGATGCATGTGACCATGTTGCGTTGTTATTACTTACA
GAATGACTTTCAGGACTTGGTGGACGGGATGATGCAACAATTGTTGTCGAAGGACGTCATGTATGACCCAATGAAACAGATCTGCGAACGGGTACGAGTA
GCTATATGCAGGTGAACTTGTGTTGATCGGAGGTTAATATTGAACGGCTGGCGTGTTGTTTAGTATCCTGAGTGGTTGGCTGAAAAGGAGTCGCTACTAT
CGAAAGAAGACTATGAAAGGTGAGTGGTTTGCGTGCGTGTAGCTGCATTCCATGTCAAATGTCATTCTTAACAATTCGGCGGGGTGATGTTGGTAATTCA
CAGATACGGCAAGCAGTATCAGTACTTCCAACAGATTGTCGCAGTCTATGAGTCGGAGCCCGACAACTACACTCGACTGTCAGAGCTTATGCAGGAGATG
CAGGAGACTGGCCAACCTCCTTCGGAGATTGTCAAAGACCTTGCTCCAGGTAACCATTCTTTGACATCGATATGAACGTGTAAGAGGGCTAATATCTGTT
GTCGTCCATGTGCGCAGGCTTGCAATTCGACGACGAAGGAATGCCGATCATGCCCAACATGGTCTGACTTTTGTTGTTTGGTACACGTACAGTTGATGTC
GAGTCTAACTTTTTCCACAGGGCCCTGGTATGTTCCCTGGTATGGCCGGAATGCCTGGCATGCCCCGTAAGTCCTTCTTCCCTGAGTTTGGGCTACATAC
CTCACTAAATATTTTCATTGCTGTTGATATAGTTGGTGGTGGCCCTGGCCAGGAGCAGTGCTCTATCATGTGATCTGATTGAATGACAGATATTGAAGAT
GATCGTTGTAGTGACTACTACATATTACGTCCCAGTATTGCTAGAGAATTGCAACACTAACCTGACCACATGTAGCTCTTCTATCTTGGAGTCGGCGCCT
GTTCATTTGTCGGAATCCATTCGAGACAAATGCAACATCTTGATGCGATTTCCCTTGGTGTGTTTTCGTACTTGCAGGCTCATGAACGTGTATCTCGTGT
CGAATCGATGCCTTTCGTTGGGGCTACTCAGATGGAGCTAAATCTTTGGGAACAGGTACGAGGGAAACTAATTATCTGATAACCATGGAAGAATTCTGAC
ATCAATTCAGAAAAACTCGCCTAATGTGCTTCCAGATGACCTGAAGCGGTTTTACTCGATTGCGAATGGGCTATCAGTGAAATGGTTTGCACCATTCCGT
GGTAGGCTTTTACAATTCCACTTGAAGAACTTGTAAAGCAATGCTGAAATCATTTTGTTCAGATCACTCTACTTTAGTAGGTCATTTTTTGCTGAATTCG
ATCCAGGACTTGCAGCACCTGTCGATCAAGGATCTCCATTCGCAATGCCGTGTTGCAGATCAACATCGGCTCGATTTGAGAAAGGTATGGATAGAAGTAG
TATTCCGGTATATTCATCAAGTACTTTCATCTCATTTTTTTCGCCAGATCAGCCACAAGGAACTGGTTGGATTTTCACTTGAATCATCTCCGAAATACGG
TACCATTGTTCTCGTCTATCTCGACGGTACCTCTTACTTGGAGCTCTTTGGATTATTTCCTGGTTATCGTAAAGCTGAAATGTGGGTTCTTCTACGTGCA
GATGCACCGCAAATCTGGTTTAAGGACTTACAGGGAAAATGGAGCTTTCTCGCCGAGACATTTACAAATTACTACCGCATGATGCTTTGTCACCTGGGCA
TCATTTCATGGCAGGTAAGATAAAGCGTACCGGACAGGAGAGTAGAACTCTAAAACTTCACGTAACATTGATGTGGGGATAAACAGACCATCTTCTCGGA
CAGTGGTGTTGACCCCACGCACAAGGTGCGTACCTTGTGGCTATTCCGATTTACGTCCGAGTCTTATCAGCTCGAGCATGCTCTGTTAGCCATGGCTTCA
CTTGTTCATCCCAAATCGAATGATGATTGACGAGCGGAGTACTCAAGATCAATGTGGCATTAGAGATCAGCACGAATAATGCACGCTACCTTTTTCCAGA
TGATACGTTTTGATAGGATTTAAACAAGGCACCGATGTATTCACTGGGTTAGCCATTTGAGGTCAGACACAGCGATCTTGTCGGGCGCACTATCATCTTC
CAAGCAAAAAATACTCTCGTCTTTATACTTCAGCATGCCGTAGTCTTTCTTCGAAATCGCCACTACCCTTCTCTTTACCTGCGATGACGATATGTCCAAC
ACTTTGACGGGAATCTTCGATAACTCGGGGTTATAAGGCTCACTGATCAACAGACATAATGCAATTACGTTAGCTTTTATCATGAGCACAAAACACAAAT
ATTATCCGTACCGTTTCAGCATGCCGACTTGAAGCATAACACGACCGTTATTGCTATCATTTCGCTTCGACTGGGAACCTTCGTCTTTTCTGCCATTAAT
ATGAATGCTCAGGATCTCGCAGACGTTGAACAGCAGATAGTGGTCAGCTGCACCGCCCAAAATGTCCGCCATCACGAGTTCACCTGTGTACAGCTTCAGT
GTAGTTCTACAAAATTCAGAACAACACGTTGAGCCATCACAGCAGGGATATTAAGATCATAGTTGACAACGTACTTGTCACTGTCACCAATCTCAGCGCT
AGCTGCGACGACATCTTCACAACCAACGCGCTGCGGCTCGAAAGATGGCTCCTCAGGATCTAGCATTTTCTGAATAATCATGGTCATCAAACAAATGTTA
ATACACGCTAACACTAGCCTTCACAACTCTTGACAGATGCCTACCTGAAGGATCATGCACTCAGTAACCCACTGGAAATTCTTAACGGGTAAGTGACGCT
TTCTCTTGTAGTACCGACATGTCTAGAAAATTCATAATACACGAAAATTAGAATACTGACGTTCGTAGTTGACAAGCGAAGTCGAACTAGTGTTTACCGG
TGTATACTCGTCGCATAGCACGACGTTCACGCTAACACCACTCTTAGTGGACAAATTCTGCAAGCAAGTGTCAAATGGTTAAATGACAACCACAATCATG
CAAAAAGTGATTTTTAGGGAGCTAGCTCACCTCGTATACAGCGTCGGCGCCACAAGCCTTCAAAATAAAAGCAATTAAATTGGCTTTGTCCTTCGCCTCT
GCCTTTGACATCTGAGAAGCATCACTGGAGATGCCGAAGGAATAACCTTCAAAAATATGTAACTGATTGGATAACAGCCGCAGCAAAGAGTTAATACAAA
ACCCATGTATGCTTAAGCGCAGCACTAGAGATATTTACCTCTCTGGGGGGGAAACACTCGAACTTTCGAGTGGTAACGGAATATCCTGTTGGTACTTGAT
ACCCATCGAAAGGTAGCACATACCCAGCTTCAATGCAATCTTTGATCCAGTCAGTATGGACAACAGGAATTCCACAAGCAACAGCTTGCATAAACTTGCG
TTTCCTCCACGACACAGGCGTCGCGATCACTACCGCCTTTGGGTTGTTTTTGTACAAGACATCCTGGTAACGCTCGGGTATTTTACCTCCGTGTCCTTCA
ATCAACTCTTTCAAATTTTCTTCTCCTGTTTTCACGAAACCCGTCAAGCAAAACTCAAACTTGTACTTGAAGAGTGTCCGAGATCTTGAAACATACGCAC
GTTGTGATGGTACTGGCATTAGCGTCCTAGTTCGTGTTCGGACTTGTGGGGTTGAGGAAGGTGTTGACTGAGCGGATCGAGTGCTACGTCGTGCAGGAGG
TCGCGGAGTAAGTAGATCATCAGCGCTAGACTCTTCCGGCGATAAACTGCCGTCAGGAGAGAAGACGCCACGCTTCCTTTTTTTGGCTGGAGGGGTAGAC
GAAGTTTGGCTGGAAGGGTCTGGGAATTCAGACGATGTTTTCTGCTTCTTTTGGTCTGTAGGTAAACCAGCCGAGGAGCTAATTTTCCTCTTCGAACTGG
CCTGAGTGCTCGTCGTGGATTCAGGAGCGGCAGAATCATCTACCAGCGTTGGCGTTGGTGTTGGTGTGGGCAAGTACACCGGGCTAATAGAAGACTCGAA
AGGACTGGGTCTGTCATCCTTAGAGATGACTTCTATCCTCTTAGTCGCTGGTGTACCATCACTTGAAAGACTCGCACTGAAGTGAGGCTCACCTTCCTGT
GACTCTGGCATGGCGAATGAAAATTCGAGACTGCGAATTGCTTTCGTCTGAGAATCGGTACCAGAGATGTGCTTGCTAGCCAATGAGTCATCACTTTTCT
TCTCGACGTTTTGCTGAGAGGGTGAGTTCGGCTCGACGACGGGTTCAACTTCTGTCCGAGGCTTACTAGGCTGAGTGGGCACACACTCATCTTGGTCATT
ATCGTTTTGAGAAGGTTTAGAAGCTTGTTTCACATTATCGGTGGGGACAACGACAACAGTGGGCACAGCATTCTTTTCAATAG