Description :
From Genome Similarity Track
Location :
scaffold_41:49240- 56006
Transcript NameFunction/comments
g1823.t1hypothetical protein
g1824.t1hypothetical protein

Sequence
6766 bases(100 bases per row)
GAACGCCGATGTGGGAATACCACGCACACTCCTTAGAGCTTGGGCTTCATACCAGTAGCTTAGGCCGATATCATAGTATCTTTCCGCTGCCACCGCGTCA
CAGCCATCCGAAACTTCGTTTCCGTTATTGCTGGCAAGTAAAACAGCGGCCTTGTATGCCTTCCTTCCTGCGCTAATAAACTCCACCCAGCTGGACCCTT
CGCTGGAAAAGTTATCGGGCGACAAGTAGAAAGCAAAGCAATGAATATCACCGATCAGCTTGCATGCTTCTACTGATCCAGAAAGAGGCGAAGTTGATGG
TAGCCCCTTCATCATACGCGATGCCTCTTTCAGATTAGCCGCAGCGTTGCCGTACAGTCCTTCAGCGCACAAATATTTAGCTTGCTGGAACAGTAAGTCG
GAGTAAATCATTGTCGCGACAGTCACGTCTGGTTCACCATCAGACAACTCGCCAATAACAACCGGCTTGATACGTTCCAAAGCGTCTTCAAACAACAGTA
ACGAGCCTTCAATTCGGGCAAGTTCACAGCGAACACACCAGCTGTCTTCACCCAACTCGATGGCCTTCAAGTATGACCTTTGCGCAGATACTTGCTTATC
GAAGTTCAGGTAGATATGTGCCAGAATAACCCAGTAATGCGCATTCATCGGGTCATTGCGCAGCACTAAGTGCATCTTTGCCACGGCAGTCTCGTCATTT
TGCGACACTAGGTGCTGCGCAAATCGAAGAAGGGCCCATGTCGGGGCCGTCTCTTGATCCTCTGTCACTCGCTCCCAAAGTTTCACATTCACCTCGTACT
TATCCTGTAATTCATACAGGTCACTGAGGGCTGTGCCTGCCAACTCGTCAATAGAAGAAATCGATAGTGCCTTCAGGTAGCATTTCTCTGCGCGTAGAAT
ATCTTTTGCGACTTCTTGATACCATTTTCCCAGCCACGCGAAAACCTCTGCGTCAGAAGGTGTCAACTTTGCAGCTTGCAATAAATGGCCAAAGCATCCA
GTCTTTGCCGTTTGGTGAGCGCCTCCCAAGTGCCAGTATACAATCGCCAAACGCTTCAGTGTTCGTCCCCTGGTGATAACATCAGTGGGCGAAATCTTGC
TCACGTTTGCCTCTAACAGCGCTTGGGCCTCCTTGAGACCACCAATCTGAAACTGAAGCCATCCTCGTGTGCACTCCAGGATGGCACTCGTGCTTTCGCA
TACTTTTAGTTCAGACACTCCAGGCAACGAAATGACAGCCATGGCGTCCACAGGTTGTGACTTTCTAAGCAAAAGTTCTGCTGCAGCAATTGCCGCCTGC
ACCGCAAAAGCAGCATCACCACCCCCGATGACACTGCGGTAGAGCTCCAATGCTTTATCCGCTTCACCCGAGTATTCGCGTGCGGTTGCCGTCATAAATT
CCACCATAGTTTCCGAGTATCTATCCCCAGAACGTAAAGGTTAGGTGACATTTTACAAACAGTTAAGGATACAGGGCATCACTTACAAATCTGGAAGCGG
GCCTCCTGAGCCCAGTGTCAGCATTTTGTCAGCTACAACCTTCTTAGCCAACGCTAACCGATTTAGGCAGCCTTCCACATCGCGTGCCGCACGTGCAATC
GACGCAAGCTCGACTTGAACGCGGATGCAAAGAGAACACTCTTGAAAGGATGAAGAGGAGTACCCTGCAAGCGCTTCAACAAACGTTTCTCGAGCCTGGC
ACAACAAGACGAAAGCACACCGTCAGCAGCTGCCTTACTTTGTAAGACCATGCCAACTTACCTGAATGCTATCCCCAGCATGCAAACTCTCGATAGCTTG
AAACACAAGAGCCATAGGACTCTTAGGGTGACGCACAGACAGCCGGGCTCCAATCTCCGAAGCCTTCTCCGATTCAATTGCTGTATCGCAATCCGTGGTT
AGTATCACGCGTGATCAGAAGTAGATGCAGTAGTGTTTGAACGTACGCGAGTCCTGGTCTTCAGATCGGAGAAGCAAGAACTCTGCCGGGATCTTTGCTT
CAGGAAACCACTCAACGATCGACACTGCCAGCGAATCCACCGTCTTAAGAAGCCCACGCTTCGTTTTCGACTTTTTCAAGGCATTCAAATGAAATCGCAT
GAAGAACGCAATTGCGACGTCCACTTTCACTCGAAGTGCGTTGATCTCTTCACTCTGAACTGTCCAGTCCGTACGAGCTGCAACAGCAAAAAACTGCTTC
GATATATCCGCCATAGAGTAGCTACCTGAGCATTCCGACAGACCAAAGCCTGGACGCTACACCACGAACATAGCATTCTTTTAGGATTTCGACAACATCC
AGCTGGGCTAAGATATTCCAGTAACGTACCTGCAGCAGATCACTTAAGTCCAGCCATATACTTAGCGAATCCGGAAGCTCCTCGTTGGGGGTCTTCTCGA
GTGAAAGCTGCTCTAACTCTCCATCCTGGTCACCCACTAATGCGTACCACGAATCAAAAGCCTGTACGAGCCACAAAAATAAGTTAATTGAACTGGTTTA
GAACTACGTCAGGTTGCACAGCACAAACCTTCGCCAGCATCTTCAGCTCCATCGCAGTAGCTGCGACCTCAGCCACCCACTTCTGGCATTTCTTCAACTT
CTTGCCCCTACAGACCACCAATACCGTTAGTTTGAAAAAACAACCTTTACAAATTATAATTGATCCCCATACGCACCTCAAATTGATGTCCACGAGCTTC
TGCAGCGGCTCCAACTTGCTCTTCACGTCTTTCTTGGCGTCGAACAGGTCCACAAGATACTGTCCAAACCTTAAAATCAGTATACAACCATTAAAACCAC
CTATATCCACGACATCCCCACCTTCCAGGGTGCTGGAAGTTCGGGCTTCAGATCGGCAGCACGACGATATGCGTCCTCGCAGTCTTCCCACTGCGTAATA
GTCAATTACATGAGCGTCATGAGCAAAAAACCACCGTAGATTTGGGCCACACACGCACCTCCTGCAGGTGGAAGCTGGCCAGTCCCACGCACATTAAGGC
CTGAAAATTGTTGGGGTCGAACTGCGTCACACGGCGGCCAGCGTCCTGCGCCTCCTGGTAGCGCTCAGCCTTGAGCGCCGCCGCCGCGTCCAGCAGCATC
TTCTTCAGCATGGCCGCCGACATTTTGGTCCCAGTGCGGAATGCGGAATGGAAATGGGCACAATATCTTGCCCTTATTTTGAGTACTTTGCTCAATAATA
GATACCCGTCACAAAAATTGAGCCAGTTGAACACAATCATTCGCCCAATCGGAAGACCCCGAAGACCAATGTGGAAGGCCGGAGCGCGTGCGGCTTCGAC
GGCGGCGCGACGCTCCCTCGCGTCTCCACTGGCTCAAGCACGGGTTAGTGGCAATGGCGCGTGGTTGTGTCGACGCCCGTGGGCGCTACAAACGCTAGCG
CGGCCGTTCTCCTCCTCTTCATCACCTCCAAGTACGTGGCAATTCGAGCGAGGCGTGTTACTGAGCGGTTGAAGCTGACAGATACTTTGATTTTATTCAT
ATAAAGCCACGCAGAATGCGCAGATGGCTGTGGTGGCGCTGGCGGCAGCTGGGGTGGGCTACCTATTTGTGACTACGGAGCGTCAGAGTAAGCAGGAGAA
GCAGCAGCGCGAGCTGGAGATCAAGCGCGAACGCAAGCTCAGTGACCGCCTGGCGGCGGAACTTGTGGCGGCCGAGGCGAACCAGAACAAACTGGACTGG
AAAGCCACGCTGGAGCGTGTGGTGCCGGCTATCGTGAGCTTGAAGCTTAATTCGCCCAAGGTGAGGGGAGATTCTGTTGCCGGCATCAACAATTGTACTG
ACATGGGTGATTGGACTTTTATAGTTTTTTGACACGGAGTCACCGGGCAACGGATCCGCGACGGGATTTGTGGTGGACGCGGAAAAGGGAATCATTCTGA
CGAACCGCCACGTCGTGGGACCTGGTCCGATTGTACGGTGGATGACAACAATGTTTTGGTTGCTACGGTGACGGCTATTGACGGGATGTTGGTGTTTATA
TGTGCAGGATGCAGAGGCCGTTTTCCAGAATAACGAAGAAGTCCGTGTGATCCCCATTTATCGCGATCCGGTTCATGATTTTGGGTTCTTCCAATTCAAC
CCGGCGGTGAGCTTGTGCCTGTGTAAATTTGTTGGGGGCATTTTACTGATAGCTTTTGGTAACAGGATGTGAAGCACATGTCAGTGCCATCACTGCATCT
GGAGCCGGAGAAGGCCACCGTTGGAACGGACATTCGTGTTGTGGGTAACGATGCTGCAGAAAAACTTGCAATTGCTAGTGGCACGCTGGCGCGTTTGGAC
CGTGATGCCCCCAACTACGGGTACAACAGTTACAACGACTTCAACACGTTTTACTACCAGGCATCTTCAGGAACGACCGGAGGCTCTTCAGGTTCGCCGG
TGCTCAACCATGATGGCGATGCGATCGCTCTCAATGCCGGTGGCAAGATCGGCACGTCAGCGTCGTTTTATCTCCCCTTAGACCGAGTTAAGCGTGCATT
CGACTTAATCCGAGAAGGCAAGGACGTGCCGCGCGGCACTATCCAGACGATCTTCAATTACAAGCCGTTCGACGAGGTCCGACGACTGGGGGTAGACCCT
GCCACTGAAAGGCTCGTTCGCTCCTCTTTTCCACTGGAAACAGGTATGCTGACGGTGGCTGAAACGATCCCTAGTGGTCCATCAAGCAGCAAGCTTCAGC
CAGGTGATGTGCTGGTGCGAGTTAACGGCGAGCTGATCACGCGGTTTGTTCCGCTAGAAGCTATTCTGGACGACAACGTCGGGAGTGAGGTAAGAATTTC
TGTTATATGCAAATGCTCTAGGATACGTGGCTGACAAGTTATTGTTTTTTTCTTTTTACGATCCTGTCTTAGATCGAGCTTCAAATCGAACGCTCAGGGG
AGCTAGTAACTCACAAGGTGCCGGTGCAAGACTTGCACTCGGTCACTCCATCACGCTTTGTTGAGATTGGAGGTGCTGTGATCAACCCGCTGTCGTACCA
GCAAGCACGCAACCATGCGATGAGTCCAGGAGCGCCTTATGTTGCTGATCCAGGCTATTTCCTTCAACGTTCACGCATTGGCCGTGGTGCAATCATCCAC
TCGGTCAATGGTATTAAGACGCCTGACCTCGAGACCCTCAAGAACTACCTGAAGCAGTGCAAGGACCGTGACCGTATTGTGGTCAAATTCTCGAAGTTGA
CGGATAAGTCGGAAAAGGTTGAAGTTGTTCATGTGGACCGTAGGTGGTTCCCATTCTGCGAGTACGTGCGCGATGACAAGCTCGGGACGTGGCACTGCGA
GCATTTTACCCCGCCTAGTGCAAGCAGTAACACTGATGAAGACAAGGTCAAGGGATCAGTTCAAGATGAGCCGATTGGCTCAACAACAACTCTGCCTGGA
AAGAATCCCGTGGAGAACAAACTTGCCCGGTCGTTGGTGACTGTGGACTTTGACAGACCGTTCAGCGTGAATAGTTTGTCAACATCGAACTACCGGGGTA
CTGGGCTTGTGATCGATGCGGCAAAGGGGCTTGTGGTAGTCGATCGCAACACCGTGACAGACTCGATGGGTGATGCCATGGTGACTTTCGCGAGCACCAT
CATGGTCCCCGCTCATGTGGTATTTGTCCATCCTGTACATAACTTCGCGATTGTGCAATATGACCCGAAGCTCATTGGGTCCACGCCCATTGAAAGCTGC
CAAGTGGCCTCAAAGCCGTTGACACCCTCCGATCCAGTATGGCTCGTTGGACTGATGAGTAGCGTGGGACGCAGTGGTCACTCCGATCTTGTGTCGCGCG
AGACAATTGTGTCCGGTGTCAAATGGATCGGCTTGCCCATGCCCAACCCGCCTCGGTATCAGGAACATAATCTGGAAATGGTCTCTCTGCAGGACGTTGT
TGGCACCGAAGGTGGAGTTGTTTGCAGCGACGAGGGCGAGGTGAGCGCCTTCTGGGCATCTTTCTCGTTCCAACAGCAACGCCGTAGTTCGAAGGTGGAA
AGCCAATTTAACCGCGGCATCCCTATGGATCTGATCATGGAAAGCGCAGCACCTCTCATGCGTGGCGTGACACCCCAAATCTACGATCTGGGTGTTGATT
TTGAACACTTGAGTTTAGCGAAGGCTCGGGAACTTGGGCTTGGCCAAGCACTGGCGGAGATTCTGGAGAAGGATGCTCCCGATCGCCGGACCATTTTGAG
CGTTGCTCGACGCTGGGGTGGTACAGAGGCCCAGGACGTGCTTAAGAATGGCGATATCTTGGTGGCCGTGGATGGTAAAATTGTGACGAGCTTTCGAGAG
GTTGAACGCTGCACACAGAAGCCGGAGGTGCAGCTCACGATTGTGCGCGATGGTCGTGAGATGCAACTGGATGTGAAGACTCTTTTCATGGAACGCACGG
AGATCAATCGCATCGTGTTCTGGCAAGGTTTGCTGCTTCAAGCGCCACCTCTGTCTGTGTCAGCGCAGCGCAGCATATCGTTGGACGATGGAATTTATGT
GTCCTGTCGGTACTCAGGGTCGCCGGCTGCTCGCTATGGACCGCCACCGACGAGTCGCATCAAAGAAATCGACGGCATTAAAATCACAAGTATCGACGAG
TTCCTGAGCATCGTTACTGCAAAATCGACCAACGATTCGGTACGCATTAAGTACACGGACCTCAGTGGCAAGGACCGCCTCAGCACGCTTAAGCTCGAGC
CTAAGTACTGGCCTACCAGCGAGTTGGTGAATGAAGGCGGTGAGTGGCGTCGACACCAACGCTAAA