Description :
From Genome Similarity Track
Location :
Scaffold_12:492337- 499651
Transcript NameFunction/comments
Phyra_75404cleft lip and palate transmembrane family protein pu
Phyra_75405Hypothetical protein
Phyra_754062-oxoglutarate dehydrogenase E1 component, putative
Phyra_75407N-formimino-L-glutamate deiminase

Sequence
7314 bases(100 bases per row)
CTCTGAGGCTCGGCATGAGCCAGCAACAAACTAGTGTTCTTTGCATTGGGTCTCGGTGCGTATTTCACAAGACTAGAGGACTGGTGGATTGTCCTGTACT
GGTCATAGTGCTCTGCATCCTTCGGGTCTGGCGAGAAGCCTGAGTGCGTCACGTGGACATGCAGATACACGGAGGCGTTGCTCTTTAGAACACCCCACAC
CTGGCCCCCCGCCCCAGAGTCGTCTGCGAACTCTGCCAGCGTCTGCTGAGAGACATTGAGGTCCAAGTGTCTGGAATTTGAGTCTGTCCAGTCGAAAGTG
AGCGATCTGAAGACCCCCACGTGCACGGCGCCAGCGCTGAAGTCCTCGAGCACGTCCCATTCAGCACGAGGCGATACGTAGCACGTCACGTCGAGCGGCT
GTCCCTCCCCCCACAGCGGGTCCAGCGTGTTCGGGCTGTCGGAGAACGTCGGATACATGATCCGGTATACCTGTCAAGTTTCCACTGTCAATAGGTATAC
TTCCTTCAAGTGACCACGTCTTCTAACGCACCTGGCGACCCACGAACGCCATGTACGCCGACTACAGACGTCATATAGCACCGCAACAACATCATAACAT
CCATATACAGCAGCAGAGGGCGAGATAAACAGCAACATTCCACGTTAGACCGCATCCCCGCATTTCTGATGCTGCAGATCGCTCTAGACGTCCGCTGACG
CAGCAAAACACTCACAAAGATGGCGCAAGAGACGGTGGTGAAGGTGATCCACGTCCACAGCGTCCGGAAAATCCCCATGTCGCCTCAACGTGCGCTCCGC
CCTCGCAGCTCGTGGCAGATTCCGCACTGGGGAGGAAACGTGCGTTGCATCTTGTTCGTTTTTTACCAAGACGAAGTGTCTACTGCCACGGATGTGTTTG
GGTGATCCACACATATTGAAGTGACAGCCGCCTACATGCATAAAAGAGACAAAACCTTGCTGGGAGTCCGGTGCGAGCGGGAGCGAAGCAGAGCCAGAGT
GAAAGCCGCACGGGGTGAATCATTCCTGGTGGAGTTAGTTTTGTGTTTGGGGAGAGAAGCGGCGCCAACCCACGTGAACTTCACGGTGAAGAGCGTGCTT
TAGGGTTTAATGTGGACCACATACGCACCGGTGGCAGCAGCAACGTCCGTTTAAAATCGTCGAGATTGGTTGGATTGGTTAAAAACCGCCAACGGGCTGT
GCGCCAGTCAACGTGGGCATCATTAAGACTTTGGCTGGATGGCGAGTATGTTGCTGGGTCGGAGGCTGCTGCAGACGACGCCGCAGGACGCACAGGACGG
CGACGAGACGCTGCTTGCGCTGCAGGCGCATGACCGCTTCTTCTGCGACACGATGGAGAACATCCCGGCGGCCTTCTACTTCCCCACGGACGCTGAGGCT
AACTGGAAGAAGTCGGCACCCAAGAAGTACCACAAGGTGCGGCTCGTAGACCGTTTCTCGCGTTGTTTTCACGTGGACGAGATGCGCGCGTATCTTGCAC
GGAGATTACGCGTGTTGTGAGCTGTATACGAGGCCTGGAACAGCGCTGACCGCTGGATTTGCTTTGCTACTACAGAACGTGCAGGCGCTCAAGCAGCAGG
AGCCGACCAAGAAGAACCTTCTGAAGCGCGCCAAGTTCTCACCGGCTTCGCAGCAGAGCAACGAGGAACGGCAGCAAGTCACGGCCGCCGTCGAGCAGCA
GGAGAAGGAGCAGACCAATGTGAAGCCCGTGAAGCCCAGCGCGGCCAAGGAGGAGGGCGGCCTGGACGGGCTCCGTGCCCGTCTCGCAGTCAAAATCCAG
GCCATGCGCGAGCAGCGCAAGGCGGAGGAGAAGACGGGCAAGAAGCGCCCGTCTCGCGCCGAGGCGGCGGCCGAGCAGCGCGCGCTCAAGAAGCGCAAGA
CGGCGGCCAGCAAGAGCAAGGCCAAGGCTGACAAGCGCGAGAAGGAGGCGGCGGAGAAGGCCGAAAGCGAAGCACAGGCTAAGGAGAAGGCGGAGACGAC
GGTAGATGCCGCGTCCATTTCGTACGGTAGTTTGCTGCTTGACGACGGTAGCGCCAAGGACGACAAGCCCAAGACTCGTAATGGACAGGGCGTCCGTGGC
ATTCAGAACCTGCTTAAGAAGGCCGAGCGCAATGCTCAGCGGCTTGAGGAGTTAAAGAAGACGGAGGAGGGATCGGAGAAGGTGAAGGCCAAGGGCTGGG
ACACGGCCCTCCAGCAGGCTGCAGGCCAGGTCGTGATGGACGACCCGAAGCTGCTTCGTGCCAAGCTCAAGAAGAAGGAGAAGTCCAAGGCCAAGAGCAC
CAAGGAGTGGAAGGAGCGAACTGCAAAGCTGGAGGTGTCTAAGAAGGAGCGACAGAAGAAGAAGGTGGCGAACAGTCTCGGCCGTGGCAAGGAGGCTGCC
AAGCCCGCCGAGAAGAAGGGCCGAAAAGGACCGGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCACTGGCAAGAAGTCGGCAGCACCTCGGAAGTAGCTCGGAGCAGAAGC
CGAGAGGCTCCCAGGTATATAATATAGACTGCCAGTTTGCACCCAGAAGAGAGTGTATTTGTCATATAGATAGACGAGAGCGCTGGGAGGGAAGCTGCAG
TACCGAGCTGGATCCACGGACTAGAGGATGCTGCAGCTGCCACCGCCCTGGCCGCTCTGCTGCCACGGGTTTGGACCGCCGTCGTTCTCTCCGAGGAACG
GGTCGGCCGTGGTCTGGCAGTACTCGGCGACTCTGGACAGCAACAAGTGAGTCTTCTCTCGGTTATTGTGATACATTTAATGACCTCACTTTTTGGCCGC
TTCGGACGTAGTGCACGAGGCTTCGAGCGTCTTGAGGTCCAACTCGAGCCGCGCGATCTCCTCCGCGAGTTTCTTGGTGGCTGCGTCTGACATGGCTGGA
GCAAAGAGTCGTGTGGAGCAGCGAGAGAAGTGAAGAAATGGCGTCGACTCTTGTGGAGCGCCGCTTGTTATTTCGATCTTTTCGTGGCGGTTCGTAGAAA
AAAACTGCTAGCGGGGAAGTTTGCGGGTGCTGCCCTACGAAAGTTTGTGGGTGTCATCATAAGTTGCATTAAGCGCGATTTACGTTGCGTCAACCTTATT
TATAGGAATGGCAATATCTACCTCGCGCTTCACTGTGTGCGCGCGGCCAGCAATACGATGAAGGCAATTGCGTAGGTGGCATACAATAAGTCGGTGGTGC
GCTAAATAGCAACCTGTAAATGCTGATCTGTGCGCCTGCAGCATGCTGAGGCCACCTTTTGATGAGAGAGATCTGGAAAGACAAGTTTGTCAGGAAGCTG
CCAAGGTTCTTCACCGTCCCCAGTGCCGCTTTCAGAACATCCTGCTCCATCATTTCGGCTTCGAGAGATCATCTTCAGCATCGTCTGTCGGTGGTTGTTG
CGCTGTCGACAGCTTGTCTGTCTATATAGATTGTGAGGACGGAGCTCCAAGTGCAACCTTCATTACCTTCACTGGGAAGTGAACTCGACAGTGCTGGATT
CGGTCTTCCAAGACTTTGGCAACCACAACAGCACCGATGGGGGCATCGGCACAAAAGTGGATTCCCCACAGCTGACTGCAGCCATACGTCTGCAGTATTT
ACGCACAGGCAAGTTCTGCCCGTGTACCTAGTGTCGGAGATGGTACGACGACGCAATCGCCCCGATGGCCATCCTCACGACCTCACCAGGAAGACGGCTC
GGATGATGCACCGTACAAGTTCAGGAAGATGTTGGAGAAGGAGATGGACAGGACCGGTGGCCTACTGATTGTGTGCACGGAGCCGTTCACTAGCAAGACC
TGCTCACTCTGCGGGAGGCTCAGGACGGGGCAGAGCCTACGCCGGAAGCGGTGGCCCCCACGGGCCTATTCTACTGTCTTTTATTCGCCTCTTTGAAATG
GTCTTTGTCATCAGCGAGGGCAGAGAGGAGCTGGTGCACTTTGACGGGACTGCGTGGGTCTCGCTGGAAGCCATAGCTTTTATGCCGCAGCGGCGCTCTC
ACACGTACGCGCAGCAAGAAGTGCTCTCGAAGTGGTTTGACAACGAATTGCTCGTCCACGCTTCCAATGGAAACTACGAGATCGTGCATCGCTTCGTTTC
GGGGGGTTATGTCCAATCGTCACGCGGATTATTCAAGAGCGTCACGCGGATTATTCAAGGACGGGAAGACACATATTTTTGACGCGGTTGCGGCCCACCT
TATGAAATTGATTCTGGAGCAAATGGACCGGCCTGTGAACGAGGATTGTCCGATCCGGACGAAAATACGGGAGATATGGGGCACTTCGTATGTGGCAAAG
TTGGATTGAACACGGCGGATATGGGCGAGCGTATCTATGACGAATCCACGGATTTGGGGGATTTTGGCAAAATGGTTTGCAGATTCTACAAGGCTTTCAA
GGATTCTACTCCTAAGCACATTCTCGAGCTCGCGGAGGATAGGTTGCTGCTTTACCTTTCTCGCAAGGTGCTCTCGTTTCCATTTCGGAGAAGTTAATTT
CTACCAAGAGCTGTTGCTGCTGCGTCCGAGCCATTTTGGAATGGTGCAAGAGTGTTTTTACCAACTCGTCGATGAGTTCAAGGATTATCTGTTGGGCCCA
TTTCAACGGACGTCTTACGTTGTCCAGACGACCGAATTGGCGACGCCGTGGATTATTTTTCTCCTCTCAGGTGAACAGTATGCCACACGGAGTCGAGTGA
CGTCATTCACACCAAGGGTGAAAACCCAGGTTATGAAACGGATGGGGTGGTGTTGTTCATTCTGTGTATGGCCGTTGACTTTTATTGTGACTGCATCGTA
ATCGGCACAAAAGTATTGAGATATTTTGGAGTGACTTGGGAAATACAGATGCACGTCGGCTGCTCTCATTCTCCACACAACCGTACGGAAGGAGCTCATG
GAGAAAAAGTTGTTTCTTGCTAGCACCAGAGGAACGAGAGAGTAATCTATATAATACCGTTAACATTTGAATGCGTACTCCCATGTGTCTCCCGTACTTC
ATCATTGACGCAAGTGAGCTCACTCGAGAAATGCAGACACGCACTTCGTGTCGGACTCAAGACCCCTCCCCCCCCCCGGCTCGATACAACCAAACAGTGG
CGTTACTTGTTCGTATGACTACGTTGGAAAGAATCGTGCCTTTCTGAGTTCATACTTACGGAAGTCCCGCTGCCACGTAGTGCATTAATTAAACGCTTAG
CACGTACTAAACAAGTCGATTGGCAAAAGTACTCGCTGAAGAGGGCCACGAGCATTCATTCTCCCCATTTATGACCTCTCCTCGCAGCTTTAACTGCATA
ATGTAGTCATGCCCACCAGCGTGGATCATTGTCCCCAGTCTGGATCAACGGATTGATCCTCACTTCGCAACTTGCATCTTTCCCAACAAGCCAACTTCCC
CACTTCCACTCCAAGACATCATGGCCTGCTACAAATCGTTCGCTGTTGTTGGTGCTGGTTCGCTCGGCTCAATCGTCGTGAGCGAAGTCCTGCAGCGAGG
TGCCGCAGTCAAGCTTCTTACTCGCGACGCCAACAAATTCTGCTTAACAACATTGGTCTTTCAAATGTACACTTTGACCTTTAACTAACGGACTTGTGAT
CGCTTTGCGTTACAATACGCAGGACACGCTGCAAACCTTCAAAGATCAAGGCGTGACACTGGCTCTTGTTGACTACGCCAACAACGACAGTGTCGAAGCG
CTCAGTGTGGGGTCCAGTGGCCGTCGACAAGGACTACTACCAGGCTGCTTAAGTACCAAGGCACGGAGGGCATGGTGACCCCTTCTGTGATCAAGATTTC
CCACCACATCGCGACAGACCTGGTGCCACGGCGCGATTCCGATCCAGCACCAAACCACAGAGGACGTGGTGACCCTCAAATGTTCAGGTCTGCCTACCAA
AACGCATAGGCCTTGGTGGAGCCTTCGTGTTGCACGATTATCGTGATCCACTGTGGCGGGAGTTCTTGGAGACCCTTCTCCTTCCGTAAAGTTCATCTGC
CGTTCACCACGGCCTCGATACATCAACATTGGGTTAAAATCCCACAGAGATACTGGGCTTCGACGCCCCAGCGACTTTCAGGGCTCTATCGTTTCTAGGT
AAACACAAATAGAGGACCTCATTAAATGGTTATTATGCTGTTTGAGAGGGTCCTGAAGGTGGTGCTAATGTTTTTGATACTTGTGGGTCGTGACTTGCAG
CAATACATGCACATGCTGGGCCGTGAGCAGTGCAACTGGATCCGCGCCAAGATGGAGCACCTCGTGAAGGACGAGGAGTCCAAGGAGAAGAAGATGCACA
TTCTGGAGCGTTTGGCCTTCTCGGTCGTCTTCGAGCGCTTCCTGGGCAACAAGTATAACACGACCAAGCGTTTCGGGCTGGACGGCACCGAGAGTCTGAT
TCCTGGACTCAAGATACGAAATCAAGCTCAACACTTCTCTAACGATTTTGCGCTGGTCTCGCGCTGAATCGTGACCTACAGTAGATTGGTTGCCCAATTC
ACAGCAGCTCGGAGAAGATGCTACAAAATCAGAGATGCGAAAGTCATACAGAACAGTTCTTTCCTTGTTTGGTCGAAACTACATGTAGAACGTTTATTAA
GCTGAGCGAATGCCCTTGAGATCGATGCCTGCTTCACTCACAGTTTCCAGACGAAATCCGGAGAGATGAGAGACTTGTCAAATACACGAGACACGTCCTC
CAAACCACCAACCAGTCGAAATACAGGCGTCAGAAAATCGGATTGAGCCATCACGCTGGTCACGTAGCCGCCTACATCGTCCCACTCGAAGCGCGTCTGG
CCACGCACCACGATGTTCTGGCCCACCAGTTTGTCCAACAACGCTACGTTTCCGTCTTCCGTATCGAAATTCCACAGGTGGGGGAATATTTTTCGCACTG
TTGACCCCGTGAGT