Description :
From Genome Similarity Track
Location :
Scaffold_606:4923- 6661
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_606-snap-gene-0.6Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_606-snap-gene-0.9Intraflagellar transport protein 25

Sequence
1738 bases(100 bases per row)
GCTATTTTCTGTGTTGGTGCGTGTAAAGATGGAAGTATACTCGTGTTCACTCAGATCGACCCGCTCTTCGTGCTATTGGCGAGCACATGGCGCCATCGAG
ATCGGTCCATGGCGCTATACGACCTGCTGTCTCAAGACCACAACTCGTGGTTGACGCAGGTTGCAGCGTGCACCAGCGAGAAGATCCAAGTGATCTGCGA
TGTGCAGCCCACTGGTGGTGGCGCCAGCCTCGACAGTCTCTTTGTCAAGGCGAACGAGGCGAAAGTCATCAAGTGGCTCTGTGCAAAGGTGAGTTTTGCT
CATGAATCGAACTCACCGATGCGCAGTATGTGGCGCTGACGCTCTCCTGTCTATGTATTCGCCAGGTGAATCGAGTTGCAAAGACGCTCGCCAAGCACGC
GAGCGAAGCGAAAGCTCAGAGCAACAGCGGGAACTTTGACGCAAACTTTGTGCTTCCTGGACAGAACACAGAGCCCAAGCCAGAAGTCACTGCAGCTGCG
AGTACTGCTGCTATCGACCCATCGACATTCAATCGCAGTGCAATTGAACTCGTCACGGACTACCTCCCGGACGAGCTCATCGATCTGCTGTTCAAGGAGT
TCAAGTACGTGAATGGTTGGCTTCGTGTAGCTCTTGAGCCCAATGCCACCGATCCTAACCGCACGTGTGCCCTGTTTTGTAGGATTGAGAAACTGGTACC
AGTGTCCAAGCAGACTGCTTCGCCGGCGAACCCGCACGAGATGCTGCAGCGGTTCGATCGTCGCCTTCAAGTGGACAGCAGCAACCCCAACAGCGCCACC
AAGCGTGCCCCAACGCCCGCAACCGCCGCGGCCGCCAAGAAGAAGAGCAAGCTGGCGAACGTGGACCGGACAGGCATGAAATCGCTCACGTCATTCTTCA
CGAAGAAGTAGATAGACCTCCGGATAAGAGAGATAGAGACTTTGTCCAACAACAAGTATCATTCAGACTACCTGAAATGAACGAAATCAAAAGCTGCAAG
CGTACTGTAGAGCTACGTATCATGCACTTGAATTGGTTGGCTGGCGAAGCTTTGAATTGGATAGTAGTCGAGATATTGAGGATTTTCGTGTAAATGGATT
GTGCTGGTGCTGTGTGTTGGAGAGTGCATCTAAATGAGCTCATCGCCTGGACGTGGACCCCTCGACGCTCACGCGGTGTAGCGTCACGAAGTCGTTCCAG
CCCGAGAGGATCTTAAATTTGATGAACGACGCGTCGCCGAGCTTCACACTCTCACTCTCAATTTGCATGTTGCCATCGTTCTCAGTCAGCTCTGCGTCGA
AATACACGTCAATACGATAAAGTCAGCCATCATCACCAAACACAATCTCAATAGCCACCCGAGAGCTATAGGTACGCACTGGAGTCGAAGAGCTTCTCCC
ACTTCGTTGGCGTGGGGCCGCTGCAGATCTCCACACTGATCTCTTTGACGCTCGTGCTCCAGGTCTTGACGCGAGAGATGGACGCAGTCGTGGCCAGCTG
CACCACCACTTCCTGCGGAAAGCTGCCTGTCGTCACCCACTTGGTTGTCTGTTCTCTGCATGAATTTTGTTTGCAATGCCACACAGTGAGGAAGATATAC
ACACACGGCGTGCATGAATGGCAAACGAGCAGCTACAGGAGCAACGTACCCATCGAGGATGTTACCGGGCGGAAAGTTTGGATCGAAGGACGTCGCGGCT
GTCACTTGCGCGCCTTCTTCCTCCAATGTCAGATCCAT