Description :
From Genome Similarity Track
Location :
Scaffold_474:4922- 17613
Transcript NameFunction/comments
Phyke_g9763hypothetical protein PHYSODRAFT_334024
Phyke_g9764hypothetical protein PHYSODRAFT_524024

Sequence
12691 bases(100 bases per row)
TgtacgaagacggcgtgAAGGCCCTAATGAACTACCCGATCGAAGATGCCATTGATCGCAAGAATTGGCTCTTTGGGTACTCGGCGCAAATGATTATCCT
CGTTGACCAGGTATTCTGGACTCGCAATGTCACAGAGGCCATCGCACAAGTTGAAAGCGGCAGTGACCCTCTAGCTGTTGGCGGATTTCTCCAGTTCAGC
TTGAAACAGATTGACGGTATggtgcagctcgtgcgtgGGCCACTGaccaagttgcagcgcaTTCTCATGGGTGCTATCATCACAATTGATGTGCACGCTC
GAGATGTAGTACGATCGCTGGATGACAGCAAGATTTCGTCGCTCAGCGACTTTGAGTGGACACGCCAGCTGCGGTACTATTGGGAAGATGATGTGAAAAA
TTTCGTAGCACGACAGACCAACACGCGGTTCATCTACGGCTACGAATATCTGGGGAATTCACCAAGGCTTGTGATCACGCCGCTGACTGATATTTGCTAC
ATGACACTTACAGGTGCGCTTCATCTACGCCTTGGTGGTGCCCCCGCCGGCCCAGCAGGCACAGGCAAGACCGAAACCACAAAGGATCTGGCCAAAGCCC
TAGCAGTGCAGtgtgtcgtcttcaactgctctGACGGACTGGATTACAAGATTATGGGACGATTTTTCTCAGGTCTTGCACAGGCCGGTGCTTGGGCGTG
TTTCGACGAGTTTAACCGCATAGATATCGAGGTGCTATCTGTCATTGCGCAACAGGTgctctgcatccagcaggcTATTGTGGCAGATGTAGAAGAATTC
GAATTCGAAGGAAACCTCATTCGGCTCAACACAGGCTTTGGTGTGTTCATCACAATGAACCCAGGTTATGCTGGTCGAACGGAATTGCCTGATAATTTGA
AGGCACTCTTTCGTCCCGTTGCTATGATGGTGCCGGACTACCGACTCATTGCTGAGATCGTGCTCTTCTCCGAAGGGTTTGCAAATGCACTGCCGCTCTC
GCACAAGATGACGCAGCTCTACTCACTCTCAAGCGAGCAATTATCAAAGCAAGACCACTACGATTTCGGTATGCGTGCTGTCAAGTCTGTGCTAGTCGCG
GCAGGTCAATTGAAGCGCAAAGAGCCGGAGATGCACGAAGACTTGCTACTGATTCGTGCTATGCGAGATAGCAATGTGCCCAAATTTCTCGAGCAGGATC
TTCCACTTTTCCGCGGCATCATTGCAGATCTCTTTCCCGGCGTGGTGGTGCCATTTGTCGACTACGGACTGCTTCAGAAAgccatcgagcagcagttgga
tTTGTTGCACCTCCAGCAGGTGCCATCTTTTATTACCAAGGCTATTCAGGTGCACGAGACGCAGCTCGTGCGTCACGGTATGATGCTCGTAGGTGAGGCT
GGGAGCGGGAAGAGTACCAATTGTTATGTGTTAGCTCGAGCGCTCACGCAGCTTTTCCAAGATGGAGTTGTTGACCGCGATGGATTTTACAAAGAAGTCC
AGCGGCTTATTCTAAATCCGAAGTCCATTTCGGCAGGACAGCTTTACGGTGAGTTCAACCTCCTCACAAATGAGTGGACGGATGGACTAGTACCAAAATT
GGTGCGACAGTGCGTTCAGGAAGCTGCCGAGTCCGACAACCGCAACTGGGTGATTTTCGATGGCCCTGTAGATGCAGTCTGGATTGAAAATATGAACAct
gtgctggacgacaacAAAACGCTGTGTCTGTCGAACAGCGAGCGTATTAAGTTGCCACATACGTTGCATATGATGTTCGAGGTGCAGGATCTTCGTGTGG
CCTCACCTGCTACTGTTAGCCGCTGTGGAATGGTTTACATGGAACAAGTTCACGTTGGACTTACGTCACTAGCACGAACATGGAAGGTTACAACGCTGGA
ACCACTTATTCCAACATTCCCAGAGCTTTGTGAtttgcttctccagctgGTAGAGACGCATGTCCCCGTTGCAATTGCATTCGTGCGAGAACATTGCCGC
GAAAAGGTACCTAGCAATAACGCAAACTTGATGCAGAGTTGCCTGAATCTCTTGGCATCGTGTCTGACGAGCGACACAGTGCAAGCCACTACTGTTAACA
ATCTGGCCACACTTGTGCGGATGTACTTCGTGTTTGCCGTCACATGGTCTGTGGGGGCAAATATCGACGACGCATCGCGCCCAAAATTCAACGATTTTTG
CATAAACCAGTTCCGCTCGTTGATCGACACCGGTGATGACGGTGCGCCAGTAACCAATGTGTACGAGGTGGTTGTCGACGATTCGACTTGCCAGTGGATT
TCGTGGGTCGACAAGACACCAACTTTCACGTTTGTGCCTGGAGCGTCATACTTTACAATGATTGTACCTACGCAGGACACGACCCGCTTTCGTTACCTCC
TTGAAAAGCTCATGCTTGCAGACCATCATGTGCTCTACAGCGGTGAGACTGGTGTGGGTAAGTCTGTCATCGTACAATCGTTCCTGGATGATATGGCTAA
GACCGATAGCTGCATTGCAACAACGATGAGTTATTCAGCACAAACCAAGCCCCAGAACCTGAACGAAATGTTTGAGTTGAAGTTGGATAAGAAGCGGAAG
AATTTGTTGGGCCCGCCAGTGGGTAAACGAATGCTCTTCTTTGTAGATGATCTGAACATGCCAGCTCTCGAAATCTACGGTGCACAACCTCCCAACGAAT
TGTTGCGGCAGGTTATCGACCAAGACGGTTTCTACGACACGTCTAAGATGTTCTTCAAGAACGTGAAAGatgtggtgtttgctgcagcctgcGCTCCTCC
TGGGGGTGGCCGGAGTGAGGTAACACCACGTCTAATGCGGCATTTCCACATGGTTTGGATTCCTAACCTTTCCGATGAGGTCATGCAGCGGATCTTTTCA
TCGATCCTAGGTGGCTTCCTCGGAGCAGAGCTGCCAGCCATCGCACAGACGGCAGTGCCGATAGTGAGCGCGTCGGTGCAACTCTACCGGCGTGTTGAGA
TTGAAATGCTACCAACGCCTTCCAAGTCGCACTATACGTTCAATCTGCGTGATCTTTCCAAAGTTTTCCAGGGCGTGCTGATGGTGAAAAAGGAAAACGT
ACCGAACGAAGATGGTCTACTAACGCTCTGGCtacatgaagaagcacgcgTTTTCCGTGATCGTTTAGTGGATGCCGACGATCGTGCGTGGTTTAACTCA
GCGTGCTCACAGCTACTGGAGGAAAAGCTTCGCGTGTCATGGCCGCCTGAGCGGTTCGAGAACCTTGTGTACGGTGATTATCTGACGCATGAGAATCGCA
CATACCGCCCCGTGGAAGACCTCATGCAGTTCAATTCGCTCTTGTCAGAGTACCTCGAAGAGTACAACATCACGTTTCCGAGCCAGATGCACTTGGTGTT
CTTTAACGATGCTATGCATCACATCTCGCGGATCTGTCGCGTTTTGCGGCAACCACGTGGCAACGCACTACTCGTTGGAGTGGGTGGTTCGGGACGACAG
AGTCTTACACGCCTTGCATCGTTCATGGCAGATTACAAGTGTTTCTCCATCGAGATTACTCGTGGCTACGGAGCCAATGAGTTCCATGAAGACATCAAAA
AGATCCTCATGACTGCAGGTGCCCAGAACCAACCtgtcgtcttcctcttttcAGACGCACAGATTGTGCACGAATCGTTTCTCGAAGATATCAATAACAT
ACTTAACACAGGAGAAGTGCCGAATCTATACGCAAGCgacgaggtggagaaaaTTGTAAGCCTTGTTCGTCCACTGGCCCAACAAGTAGGCAAGGTGACA
CGAGAGGACATATTACAGTATTACGTGACACTGGTGCGTGAGAATCTGCACGTGGTGCTGGCCTTTTCCCCCATTGGTGCTGGCTTCCGTAATCGTTGCC
GCATGTTCCCGTCGCTAGTAAATTGTTGTACTATCGATTGGTTTAACGCATGGCCGGAGGATGCACTCAACTCTGTGGCAAACCGATTCTTTGCCACGAG
CGCAGGGGAACTTGGTATTGAAGCGCATGTAGACACACTGTGCCGAATGGCAGTGACGATTCACCGCAGTGTCGAGGAAGCCACCACGCAGTTCTACGCG
CAGCTCAAACGACGAAACTATACCACGCCCACAAGCTACTTGGAGCTAATCCGGTTGTACGTGGACATGCTGCGCACTCATCGACAACTTGTTCGTGCGA
AGGAGGCACGATACCGCGGTGGACTGCAAAAGCTTACCGAGACGGAGGAGATTGTTGGAAACTTGAAGAGTTCGCTCACTGAATTGCAGCCAGTGTTGGT
GAAGGCGCAACAGGAAACATCCGTGCTACTTGAGCAAGTTGCAAAGGatcaagcagaagctgacaagcagcaacatttAATCCAAGCAGACGTGGAGGCT
GCTAACAAGATTGCTGAAGAAGTGAAAGTGATCAAGGATGACTGCCAAAAGGATCTGGATGAGGCTATGCCAGCCTATTATGCGTCAATCAAGGCATTAT
CTCAGCTTAAAAAAGATGATATTACTGTGCTGAAGACTTTCACCAACCCACCGCGATTAGTTGGGGTCACGATGAATGCCGTGTGTCTGCTTTTTGGCGC
GAAACAGGAGTGGAATGAGGCCAAGAAGTTACTGAATGATATGAAATTCCTGGACAAGCTGAAGGAATATGACAAGGATAATATCCCGCCGAAGACCATC
CGCCAGCTTCAAAAGTTTATGTCTGACGAAGAGTTTACGCCAGAGACTCTCAGTAGTatctccactgctgctacttcTCTTTGCATGTGGGTACGTGCCA
TGTACACGTACGACTCAGTGGCTAAGAACATTGCGCCGAAGAAGGAGAATCTCAAAGTAGCTGAGCAGCGGCTCGAGGAGGAACAAAAGCAGCTTGATAT
CAAGCAAAGTGGTTTGAATGCGGTGCTAAAGAAGGTAGCCGATCTGAAGCACACACTCGAGAACgcgcagcagaagaaagtGGATTTGGAGAAACAGTCG
CAGAAAACTCAAGCACAGCTCGTTCGTGCTGAGCGGCTCATCGACTCGTTAGGCGAAGAGCAAGGGCGCTGGAAAGAATGTGCTGAGAACCTGGCTAAAG
ACATGATTAACCTTGTTGGCGATATGATCTTGTCAGCAGGTTGTATTGCATATCTTGGACCGTTCACATCCGAATATCGCCACGAACTTCAGGCGAAGTG
GGTCTCATTCTGCAAGACCAGCAATTTGCCGGTGGACAGTAGTTTCTCCTTCCAGCGTGTTCTAGCGGACCCCGTCGTAGTGCGTGAATGGAACATCATG
GGCTTGCCAGCCGACACCTTCTCGATTGAGAATGGCCTGTTTACGACAATGGGGCGTCGATGGCCACTTATGATCGACCCACAGGGACAAGCTAACAAAT
GGATTAAGAATATGTACAAAGCGGCAGGCGTACTGCAGATTATCAAGTTGTCTCAGAAGGACTTCTTGCGTACTCTGGAGAACGCCATCCGCTACGGTTC
GCCTGTAATGCTCGAGAATGTGGAAGAGGACCTGGATCCGTCCTTAGAGCCTGTTTTGCTCAAGCAAGTCTTTAAGCGTGGTGGCCAGATGCTTCTGCAC
CTCGGCGACAGTGATGTTCCATACAGTGATAATTTTCGTTTCTACATCACCACAAAGCTTGCGAATCCACACTATATGCCAGAAATTTGCATCAAGGTGA
CTATTATCAACTTTACCGTCACGCTTACGGGGCTTGAAGATCAGCTGCTGGTAGATGTTGTGCGCAGCGAGCGTCCTGATctggagcagaagaagaacga
gtTGACAGTAAATATTGCGGCGGACAAAAAGCAGCTAAAGGAGATCGAGGATAAGATTCTGTACATGCTTGAAAATTCGCAAGGCAATATCTTGGACGAT
GAGGAGCTTATCGACACTTTAGCACATAGTAAGGTGACATCCTCAGCGATCAAGACCCGCATGGCCGAAGCAGAGACTACCTCTATGGAGATCGATCAAA
CGCGAGAAGGCTATCGCTGCGTGGCTGTCCGCGGCTCGATTATCTACTTTGCAATCGCGAACCTCGCGCTTATAGACCCCATGTATCAATATTCGCTGCA
GTTCTACCAAAAGCTCTTCGTCATGCGCCTCCAGAATTCTACGAAGTCTGAGGTATTGGAAGAGCGCCTGGACATCCTCATGCAGGATATTACTGTGTCC
ATGTTCGTGAATGTTTGTCGTGGTCTTTTTGAGAAAGATAAAATCGTGTACGCATTTATGATCGCGTCAAGTATCCTCTTACAGCATGGTGCAATCTCGA
TAAGTGAGTGGAGTTTCTACCTGGTAGGAGATAAAAGGAGCTCAGCCGTACAGGCAGCGCAGGTTGAAGCCTGTGGCCTCACACGTCCATCGTGGCTATC
GGACCGTGTATGGAGAATAGTTGTCGGCATGAAGGATATATCATCTGCCTTTGACGATTTGGCCACGTCCGTGGGGAAACACGCATCTGAATGGAAGCGA
GCAATGGTACTGTCCGACCTGCCGCACACTGAAATACTACCAAAAACCTGGGAATCGACACTTACAAACTTCcaaaagctgctggtgctacgAGTGTTCC
GCGAGGAGATGCTCGTGTTTGGCACGCGTGAATTTGTCGGACGTGAGCTTGGAACGTTCTTCACCGAGTCACCGCCGTTTGACCTGGGCGGTTGTTATCG
TGACTCCAAACCAGAGACGCCATTGATTTTTGTCTTATCGCCCGGCGCTGATATTAACGATTATCTTTTAGAACTTGCCAAGCAAGAGGGCAAGGACGGC
TCTGGACTCAAGATCATCTCTCTCGGCCAAGGCCAAGGTCCGATCGCTGAAGCGCTCATGAAGCAAGCGAAGAAAACAGGAGACTGGGTGTGTCTTCAAA
ATTGTCATCTGGCTGTCTCGTGGCTTGGCCGCCTCGAGCAGCTTTTGGAGCAATCTGCGACGGAGGAGATGCACGACGAGTTCCGTCTGTGGCTCACGAG
TATGCCGAGTCCGAAGTTTCCTGTACCCATTCTTCAAAACGGTATCAAAATCACGAATGAGCCTCCTAAAGGAATCAAAGCGAATCTTGGGCGTACATTC
CTTGACATGAAGGAGGCAGATTACGAAGGCTGCACCAAGCCACGAGAGTTTAAGAAATTGCTTTTCGCACTCGCTTTCTACAATGCTGTGTGTCTGGAGC
GCCGGAAGTTTGGTGCTGTTGGGTGGAACATCCCTTACGAATGGATGAACAGCGACCTGAAAACTGGCATGCAGCAGGTCCGACTGTatctggaagagca
ggacgaggTCCCGTATTTGACGTTGAATGTCATGGTAGCGGATATCTCCTACGGTGGCCGAATAACGGATCGCTGGGATAAGCGCACCAACTCGAGCATT
ATGCGAAAGCTTTTTTGTAAAGAGGTCATGGACGATTCGTATCGGTTCACGTCGTCAGGGATGTACTTTGCTCCAGCCGAGGGATCTTTGGCTGATGTCC
GAGAGTACGTTAGCTCGCTACCCACAGCAGACGCTCCGGACATATTTGGTCTGCATGCCAACGCAGACATCACTTTCCAACAAAAAGAAACCAGTCAATT
GCTTGGCACAATATTGAAAATGGTGGGTGGCGTCGGTGATAGCggaggcggtggcggtgCGCAAAGCAACGATAGCATTGTCATGGAAATGGTGGTGGCT
ATTCAGGAGCGCATGCCTGAAGCATTTGTTGAGAGCAAGGGGCACCCTTCAACGTTCCAAGAGGCAGCAGGAGGTAGTCGCAACTCATTGGGCGTGTTCC
TCTCGCAGGAAATGATTCGTTTCAACGTGTTGATGcaagtgatgaagacaacacTCGAGATGCTCAAACGCGCCATTAAGGGCCTTGTGGTTATGTCAGG
ACCACTGGAGAAAATGTACAATGGTTTTCTGATCCAGCAAATTCCAAGCGAATGGGAGAACGCCGGCTACCCCTGTCTGAAGCCGCTAGCCTCATGGATC
GAGGACTTCTTCATGAGAATTACACTCACCGACGAGTGGCTCGTCAATGGGCCGCCCTTGGCTTTCTGGATTTCAGGATTTTTCTTCCCACAAGGCTTTA
TGACAGCCGTGAAGCAGTCATTCTCGCGTGACAAACAAATCGCCATTGACGCGCTTGTCGTCTCTTGTGAGATTATGGCGCAGGACAAGGAGAAGTATcg
atcgccaccaccttTTGGTGTGTACATTTTCGGGCTTTTCATGGAAGGCGCACGATACAACCGCGAGACTCGGATGATGGCAGAATCGATTCCTAACGAG
CTGGTTGACCGCATGCCGGTCATCTGGCTCAAACCCATGCGACGGGAGGAGTATAAACCCACAGACGTGTACGAATGCCCATTGTACAAAACGTCTATCC
GCGCCGGAACATTATCCACGACGGGTCACTCGACGAACTTCGTCGTTGCACTCGACGTTCCCACTGACAAAAGCCCCGACCACTGGATCCGCCGGGGCTG
CGCAATGCTCTGTATGCTGGACACATAACCACACCGTAGTTAATAGATCTCGGCCTCGGTTGCAAGACATCTCATCTAATAGATATCCTTCAGTATATTA
CGCGCTTGGTTGTCCTCTAGTGGCTTCTAGCCTCCTGcgctcgtcgctgcttccacaGCTTGATGTCTTCATTAGCTTGCACTCGCTCCTCAGCTGACAA
GGCGTAAAACGACTTGTTCATCTCTCTTTCCCACTGCACAGCACACCACCATCAACTCCCgcaaaaaaacaaaaacaaaaactcCATACCTGTTTCACCT
CCCTGATCGAGTGCTTTGGTGGCTCGTACGTATGCGTAGCTTTAAACTTCTCATTATGCCTCGCCAAGAGCTctttcaagctcttctccacagtcttctc
tctcttcttcactggcCTTTTAATCTGTATCTCTGCTTCAATACGCTCCCTTTTATTCCCGACATCAGCTAGAGGTTTCCTCCCCTTCTTCTGCCTCTCC
ACAGTCTTCACCACAGTCTTGGCCTTGTTGCTCACTTGGAAAGGCTCTTGTATGGCCTTTATTTCCTTCAAAGACTGGAATTTCCGCTTGTGTTGGCTCT
GGAGCTCCTTGTTCCTAGCCTTTACGATGTCTCTCCAGTCGTTACTCGGTCGTCGGTTCTCCTTCCCAACACTGCGCTGCTGTCTCTCTTTCTTCTGCGT
CTGTTTGATCTTCTGAGTCTCCTCCGCCTTCTGTAGACGTCGTAGAGTCTCTGCTAGTTCCTTGGCCAGTTCAGCACTTGGTTTACTGTGTTCAGGATGT
ATCTGCTCGAACCACGGGTCGTGTTCGCCTGCAGAGAAGGGAGACGCGGACGCTGTGAGGTCCATGAACTGTTGGGGCGCGTCGAACTCGAACAAGTTGT
CGATTGCAGGTGGTGCGGTGCGGGTACGCGTTCCCATTGGCGCCATGTCGCCTTCCTTGCCCGCAGTTGATCGAGTCACTTGAGTTCAGTATGGAAAGAT
GGCACGAGTGAGGATACCGCGCGCCAAAATTTGAAATCAGGAATGTACGCTTTGTTTTGCATTTACGcttcgtttttttttcaatTTGGAATTATTCCTA
TTCAGAGAAAACTCCATATACGAATGTTGAAGCGCCAACAACATCCAATTTTCAGGAAAAACGTCTTTTGCCGTGATCATTTTTGATTACCTTGTATGAT
ACAAAACGCACGCTGCAGTACGTCAACCATACCGTTACGTTTTGTTCACTGTAGATCACTGCCACACATGTAGGCTGTCACTGGTCTCCATCATGATCGT
GGCTGCCATCGAGAGCTTCGGTGATGCTTTTCTGGCTTGAAACGCACGTCACCAACCCAGGCCTCGCCTTCTAGCACATAGTCTCGCGAGTGAGATCTGT
GCCGTTCATACGACAGAGATCGCTGGTACTGctcttgtagctgctgtggctgctgagtACGAGATTCGCGCCGGTGGTCAGGCGAGGGGGAACGGCGGTG
GTAGTCGTAGTCTTTCGAGTGTGAACGACGATGCGAGCTGGAGTGCGCGGAGGGTCGGTGTGACGATCGGGAGTGACTTAAGTCAGACGACCGACGGTGA
CGCTTAGTAGGAGGCACAGACGGCGACCGCGAACTCGACACTGATCTTGACTTGCTGCGTGTGCGCGAACGTGGTCTGCGAGAATACTCTCGCTTCGGTT
GCACCCTCTGACTTACGTGGTGCCGTTCAGCACTGTAGTCGCGCAACTCGCGCCGTTCAGCATAGTCGCGACTGCTACGGCGGTACGAATGAgttggcgg
cggcggtgaCGGTGACCgcgaaggagacgacgaaggaGATCGGGAATATGATCGCGAACGCGACGGAGAGCGCGATGACGACCGAGAGTAAGAGCGACGA
TGTGTACGACTACCTCGGCGAGAGGAGCGTGAAGGTAGTCTCTTCTCGTCATAGTAGCGCTCTTTTTCCAAACGAATCGGCGGTCCTTCCACCAGATAAC
GACTATGACTGTCTCGTGGGGACCGTGGTTTCTTTGCTTCGTAGTATCGTTCTTTTTCCTGACGGAATCCATCCGTCGGGTAACGACTGTGAGTCCCTCG
CAGGGTGTGCGATCTCTTCTCCTCATAGTATCGCTCCTTTTCCAGACTTATTGGCGGTTCCTCCGTCTGATAACGGTGACGACTCTCTCGTGGAGAGCGC
GGTCTCCTTTCTTCATAGTACCGGTCTTTCTCGTGGCGATTTGgcagctcctccttcgtgTGACCGTGGCTCTCTCGCGGAGAGCGCAGTCTTTTGTCTT
CATAATATCGGTCCTTATCTTTACGAacatgcagctcctccttcacaGGACCATGGCTATCCCTCGGAGAGGGTCTGGCGTGCTGATATCCGTATCCCCG
ATCTTCTCGTGTCTCTAGCTGCGCGTCATAAAATCCTCGACTTTCTCGAGAGTCTGACTGCGCGCTATAGTGTCGGTCAGATGGAGAGGGGATACGATGA
TCGGGTATGCCGTGCGGCAATGGTGATGACGGTGGAGGTTgatgtgctgttggtgtACCATGCTTGTTTCCATTGTGCGGATGCCCTGGAGGTGGGGGTG
GAGGGACGGTGTACTGACTACCCACATTCGTGATATAACGTCCAGCCGGCggaggcggtggaggcggAGGTGGATGGACATATCCCCCAGGGCGCTGCGC
TGATAAGGGCattcctggtggtggaggtggcggaggaACGGGCCCAGCATGATTGTGTTCCCATCGATGTGCTGGAGGCAATGGAGGCGGAGGCTGATGG
TAAGACGTCGGTGCCAATGGCGTTGGGTATGGCGTGTCTGTCGTCGAGCTATGATCACGCGAAGCTGATGCAACACCTCCTTCGCTCGTGGTGCGGCCAT
GTCGCCCTGTTCCCACATTTTCAGTGTCACTCACCTCCATGGAGCTATCAGTTTTCACCTGTGCTTTCCGTTGGGACTCCACGCCATCAAGCCCGTTTTG
AGCCTCAACTGGAGTCCCCTCTGCGCTAAACCCATGCACAACTTCGCTCGACGCCTGGGCAGAACCGCCAGGCGTCAACCGGCGTCCGTTCTTGATCTCC
AGGGACTGGCGCACTTGGTAGTCACGTTCACGACGCTTTCGAAGTGCATCAGAGCGCATCTTCTGCTCAGACTGACGCCGCTTCACAAAGCTCTGAATGG
GCGGCGGAGCGAACAAGCTCGTCCGTGCACgcaactgcttctccatACGATACACCGCGCCCTGCACTTGAATTCGCTCGTCAAATGACAGCCCTTCACT
GTCAAAGAACGTTTTGTATCTCTTGGCTATTGTCAGCAGCATATCCGGTGCTACGTCACTGCCCATCTGCCCTTCCGCTATTGTAGCCCACTGTAGCGCG
CGCTCGCGCTCAGATTTAATGACATCCCAGTCAGTCACAGAGACGGCAGTCGCATCCTGAGCATGTTTCTTGTCTTCgcgtgcttcttcgtcgccgCTTT
CACTACTTTCTGACACCAAATGACTCTCCCCGACGGCCAGAAGCTGTTTACGTACTAACGTGTAATCTGGGAAGTCCTCATAGCTCAGCGACTGCAGGTA
TTTCATCATGCCCATCAGCTGCACAGCACCCGGAAGTCCCTCCACCAACAAGTTTGGGTTCTTTTCGGTATAATGCTCTTTCAAACTAAGCACAGTCTCA
CGGTTCTTTTGCTGAGCATCAGCAGCCCACGGCAGCTCGCCCCGCAAAAAGTCCATGACAAGATAAAACCACGACCAGAGGTCATCCTTCGGGCCCAATT
CCTGTCGACGGTGAGAACTTAGGGACGCGTACATGGATGTGCCCCGAAACTCAGCAACAGGACGGGCAGGTAACGCCTTTCGGTCCTCTCCAATATGCTG
TCTAGATAGCCCAAAATCGATGATATAATAGCGCGGATTCTTCGCAGGATTGCGATCATTTGCGCTGAGCGCAAAGTTCGATGCCTTGATGTCACGATGC
ACATATCCATGACGATGAAATGCTTCAATGCAATCCAGCATCTCTAACCCCACCGCAACTGCCTTGGCCAATGGTACACCATGAATAGAATCCGGCGACA
TACGCAGCATCGACATGCTTTCTCCCAACAGTTCCATCACTAGCACCGTGCTGTCTCCATGTTTTCTACACAAGCACCAAATAAAAAAATC