Description :
From Genome Similarity Track
Location :
Scaffold_48:492182- 494846
Sequence
2664 bases(100 bases per row)
GGCGTACGGCCTGAGATTGATCTAGTGCCCGGCACAAAGTAGTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCT
TCGCTGCTAAAGCGAAGGCAAGCATGATGCGGGAGTCGAAGTCTCCACACTCGACGCCAACGTTCTGCGTTCGGAAGCCGAAAGGAAAGTGGCGTCTAGT
TTACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAACGGATGCGTTGTTAAACAACATGGCCGGAAGCGTACTGTAC
AGTGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGATGCGAGAGAGCGACATCCCTCTCACCGGTGAACACCCCAAGCGGCATGCTTTGGGAGTAG
CTCGTCATGCCGCAGGGCTTGGCTAACGCCCCGGCGACGTTCAACCGCCTGGTGACGCAATTGTTCCGCCCATTATGTACCTTCGTACAGACATACTTCG
ACGACATATTCGTCCATAGCCGTGCCAAGGGAGGTAAGACGGCCATCGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGATGTGATGCGAGCGAACAA
GCTCTACGCAACATCGACAAGTGCGTCTTCGCGTAACCAGATATGAAGGTTCTCGGCTGCTTCGTAAGCAACGTGGACGTTCGGGCTGACCCAGAAAAGG
TCAAGGCCATAGCAGCATGGCCAACGCCCAGATCTCAGAGGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTTCCAGGTACAGAGCAGGGTATGC
GGGCTTCACTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTCAACTGGCACTGGGAGCAAGAGCACCAGGACGCCTTTGACAGCATCAAGGCCAGTCTC
CAAGAGGCCCCTGTCCTGGATCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCGTCCGATTACGCCATCGGGAGTGCCTTGCTGCAGGCCG
ACACGGCTGGACATGAACGAGCCATCTCGTTCAAGTTCAGGCAGGTCAAAGCCGCCAAACGGAACTACCCTGGCCACGACAAGGAGCTCCTGGCAATGCA
ATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGGACGGCGACTAACTCGCCTCAC
CTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGTGGTGTACAACTTCCGCGTCGATTACAAGCCAGGCAAGCTCAACGTGCTTGCGGACGTTCTCT
CTCGGCGTCCTGACTACGATTTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCC
TATCGTCAAGCTGCTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGATAGCGCTCCCGGCTCCACCGATACGAGCTGACGAATGGCCTC
CTCTATTACCGGGTGGAGCCCAATGAACCTCCACGGGTGCTCGTACCCAACGACGAGGATCTGAAGTTCGATACCCTTGCAAAGACGCACGACGCGCCCT
CCAGCGGCCACTTGGGCCGCGAGAAGACCTTCCTATCGGTCTACCAGGCCTTCGGGTGGACCCACATGTACAAGTGGGTCGCCCGATATGTGAAGACACT
TAAAGCATGTCAGCGGGTCAAACTCGTAGGGCACTCCTCGGCTCCGCTAAAGACCCTGCCCGTACCGGCTGACAGTTGGAAGTCGATCAGTCTAGACTTC
ATCTTTGGGCTTCCCGCCGACGGACACGGCGACACCGGAATTTTGATGTTCGTGTGTCGGCTGAGCAAGATGTACCATCTTGCTCCGGTCCCCGTCACTG
CTACGGGCGACAAACCGCAAGGCTGCTCGTCGGTCTCCCGGATACGATTGTCTCGCACCGAGACCAGTGGTTAGTGGCTGCGTTTAAAAAAAACGCTGTT
TTTTTTTACTAGGAACTCGTCTGCAGATGTCCACTGCGAACCATCCACAGACAGATGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACGCTGCG
CAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTTATTGCATTTGCGCTCAACAACGCGGTGCACGCATCCACGGGGTTCACGCCG
TTCTACTTGAACGGCTTTCGTCGCCCCAAAGTGCCTCTCACTCTTCGAGGAGACACTGACGCCTCTATTCAAAGTGGGGGAGAGGCTCGGAAAGCCGTTT
CCTCCCAGGTATCGGATGTGAGACCAGTTTCGCTGCGAAAACAAGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCAT
GGCAGCGGCCCAGGATAAACAAAAGGAGTACTCCGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTGATACTAGCTACGAGG
AACCTACCTCTTGATACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACTGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACA
CCATCGACCTGTATAAGTCAATGACGACGCACCCGACGTTCTATGCTGGATGTCTTAAGCGGTA