Description :
From Genome Similarity Track
Location :
Scaffold_16:49200- 53619
Transcript NameFunction/comments
Sapdi_VS20SDRG_05868hypothetical protein
Sapdi_VS20SDRG_05869hypothetical protein

Sequence
4419 bases(100 bases per row)
GGGAGGAGCCCGAAGCGATCCAAAAGCTGCAGCACGATGTGCACGCGCACACTTCGCAGCACGCCGCCGAGCTCTGGAACGACCTCAACAAAGCCCGCGA
TACCTTGGCCGCCGTACGGCACACGATATACTCGATGGTGCTCTCACATGGCGTGCAGAAGCTGGAGGAAGAACGGACGCGGCAAGCGGCATTGACGCAG
ACATCCATCGAGGTGTTTCAAGCCTCGATCCAGCAACGGCGTGAGGAGATGAAGCAAAAGGAACTCAAGACGCTCCTTCCGAAATCGTCGTTTGTCAAGG
CCAAGCGCAAGCCTCCGTCGCTCAAAGGTGCCATCTTCATTTATTTGACAATTTACGTGCATTTTTCATGTCAATTTATCGCATTAGGACTCAAAATGAG
TATGCACACAATCCAAGACGTCCCCAACGAAGACGGTCCGGAAGACGTCGTGTCCAAAACCATTGACGACGACCCAATCCTGACGCTCTTTGTCGGGTCC
TTTGTCCGGCCCGACTGCCACCTCTCGACGAGCAGCAACACCACCAACACCATGGCGCAGCTGCACAAGCGGTCGGCCCGCAGCATGCAGCTCGAAATGA
CGGGCGTCCAGCGCATTTACAACTGCGTATTCTACTACTACCTCTCGCTCGCGGACCCGCTTGCGGCCGTCGGCATGACGTACGTCTTTGTGTCAACTTG
ATAATTTCGAGTTTGCACTTTTTAGAAAAGCTCAGTTTCGGACGTTTCTCAAGGACGCGTTGCTGTTACCCAACGCCGCAACGAAAGGGCCGCCACCGCC
GCTCAAGTTGCACACGTCCGACATGATTTACACGCAGAGCATCATGGACGACCCGTCCCTCGCTGGTCGTGGTTGCCGTTTGTTATGGTGTCCTACCTTT
GTCTTGAGTAGAAGCCCCCTCCAAGAAAGATGCTCTGCTCACGCTTCCAGCGTTCCAGGCCGCCATGATGAACGTCGCCGACCGCGTCGTGGCCCAGCTT
GACGAGAAGGTCGAGGCGACGATCGACGATGCCGGCGAGTGGCTGTGCCTCGAGTACATTCTCCCGCTCGTGCGGCGGCTTGCGGGCAAAATGGCCGAAA
CCGTCAAACGGTATTATCGACATGACAATGATAAATTGAATTATCGCGCAGGTTTACGGACATTGAGGCGCAAATGACCAGTGCCCAAGGCCTCTTGGCG
GCCAATCGGTCTCTTTTCCAGGCCTTGCACAAATTCTACAGCAGCGACTCGCGCTTCAAGCTCATGACGTTTGCAACGTTGGTGGCCTTTACGACCGACT
TTGACTTGACGCCGACGCTGTGCTCGGTGCCAAGCCTCTTTCACGTGTGCGAGGCCATCAACTGGATGTCGGGCAACGCGTACACGGTCGTGCTGTCGTA
CGACAAGTTTGTACAAATCTGCCGGACGCTCGCGGTATACCTCGACTTGCTACGAGACCATGTCGACGTGAGCGTACTAGGTCGAGTACATCAAGGACGG
CGACGACGCCACGAGCAAACTCGTTGGGTTCCTCACGCACCTCAACGCGCACCGCCACAACCGCGCGACCACGCTTTTGACGGCGCCGCTCGTGTTACCT
TCATCGTTTGTCGTCGACAGCTGACATAGAGTCGACATGTGTTTGGGTACTCAACACGGAACGTTCGTTGCGGCTTCGGTCAGAGTGGGAGCGTGACGAT
GGCGCCACATCCTCGGCCCGTCTGGTCCGTGGCTCGTCATTTCCGTTGCAGCTGATGATCTGTTGCCTGCGTGCACACGACGCAGGGTTCCTGGCTTGGT
TTTCTCGCTGCAGCTTCTCGCTGCATGTCTTTTGCCAGCGATAACCGACTCGAAGCAGCGTCTCCATCGCAATTCCCGGGTTGACGCTCGTGTTAGGCGG
GCGCACCATCCAGCTCCTTTGCTCGTGATGGCGCGAGCCTGCACCACCGTTCAACCACTTTTCCACTTTGGGTCATTTGGCTTTGGGCTACGATGTCCTG
TCCAAGTCCAAACCTATCCTACGCCTCCATCGCGTACAGCACCGCACAAGTGTACTGTTGTTGGTTGATTGGGCTCAAGACAAGAGGTACTGTGGTGGAT
AGATAGGGATTGATTGTACATTACGACACATGCAGGATAATAATTTAGATTTGAGACCATTGCGGCGCGAGCTCTTCGGTTTGGTCGGCCATCGACCGGA
GGTGGTTGCAGTGCACGTGGCAGAGGCCGCCGCCGACTTCGTCTTGAAGACCCATGCGGTTACAGCCGCGCACCAAGCACACAATGTCCTTGCGGTGGAT
CCCGCAGTAGCCGCCACCACGGTCCGTGCGCTGGCAGTCGTCGGTCTTGCAGTGGCGCGACCCGCCGTGCTTGGCGCAAAAGAGGCCGCGCTGCGCACCG
TTGTTGCAGTTTTCGTATGTGCAGCGGCGACCGCCCCCGTGCTTTCGGCAGAGGCCGTTGCCTTGCGAGCTCTTGCCGCAGCCGTCGAAGGTGCAGCGCG
CGCCACCGCCATGTGCCTTGCAGAGTCCGTGCGACTGCGCCGACTTGTTGCACGTCGGGATGTTGCAGCGCTTGCCACCGCCGTGGGCGATACAGAGGTT
CTTGCCTTGGCTGCCCTTGGTGCAGCCAATGACGCGGCAGCGGCGAACGCCGCCGTGCGTCTTGCAAAAGCCGCGGTACGTGATCGACGCATTGCAGTCT
TCGCGGAGGCACTTGCCGGGTACTTCGTTGTGTGCGGCGGGCACGTTGCTCGTTGTCGACGTCGGTGTCGTCGTCTTGGGCGCGGTCGTGGCCGGCGGCG
GCGTCGCGTAGCCCGGCAAGACGAGCGCCATCTCGATGGCTTCCGACTTGACGTTGGCAAAGTTGTTGTTGTTATCGTAAAAGCCGTACGAGGTCGTGTT
CGTGGCAGCGTCAAGATCGACAAACTGGTTGTGGTAGATGATCTCGGGCGCGGGCTGGTGGTACGGGATCGGGTCAAAGCAGAGCATCGAGTCGACAAAG
TCGATGGCGTTCGTCTGCACTTCGTAGGACAAGCTGTCGAACGCAAAGGCGTCCTTCTGCATATAGACAGCGTGCATGTTGCTGTTGTTGTCGTTCTGGA
GCAAGTCCCACATGGGCTCTTGCTTCATGCTGCTGTACTGGCCGGGGAAATTATGCGCGTCGTGAAAGTAAGCGTCCATGGTCAGCAAATGCGCAAATGA
ACTGCCGCTTGTGCCAATATGGGGCTCTTGCATTCCAGCTTGGTGTTTGTATGTGATAGAAAACCCGAGTGCTAAGAGATTGGTTGTGAGTGGCACGAGT
TATTTCGAGGTCACTTTGCCATAGCGCAAGATCCAGTAGAGCGTGAGTAATCCCAGCCGGTTCAATATCTCATCGCAGTTACTTTTGGCCCATGCACCAT
GTAATTGGGTGGGATAGAGTCATAAAGCCTTGCGACCTGTATGGCTTTCATTATTCGAGATCGTACGACGACGACGATAATGGCGCCTTGCTTGCGGTCG
ACACTCGACATGGATGGACCTCGATGCGATCAGCAGCAGCATTGAGGTTGGGTGATACTAGCATGTACCGTATTACTAAAATGCAAAGCACGCACCCAGA
TGAGCAGGCCCGCATCATCATGCACGCCGACGAGCAGCACGGTCGTGCATACAAACCGCTTCTCGAAGCGGTTTGCGTCATGCCCTCCATTAATCTTGGA
CCAGGCACGGGCGCACGGGGAGCTATATAAGATCTTATACTATGAGCGCGTACTGTACGACAGGCGTGGAGTGCGCCGCACGTGGCCGAATCAGTACGCG
ACGGTACGCGGCGTATCGGCGTTGGACAGCATCGTCAACCGTCAACTGCAAGAGGAGGAGTGGACACCCAAGCACAGAAAACATCGTCTTCCTGCTGTGG
ACAACGGTATCGACAACACCCAAGACGCAATACGATCTGAGTCCTCGACGATCGGACGTCGTCGCCTCGCAGCAACTGAGAACACGGGTGCGCTACAGAA
TACTCGTAGGACGAAGCACCCACACCTTCGTTTCGATTGAGCGGCTCCTAGAAGCCGCACATCTTGCCACGACACTGGCGGCGTCGACGAGGTCCTTTTC
GCGTAGAAAGAGCCACATACACACTTGCCTGCTGCTTGAAGCGGCTGCCACGTGGCCAGTAGCAGATGGCACCTCGTTTATTCACATTTCCAGGTCAAGC
CCACTTTGCACCTGCCACGAACGGTCGGCGCCAAAGATACGCGGCCACCGCCCCGTGCATGGACCCAACAGAGGACAAAGGACCATTTGGGGCACGAGGG
TGCACAACAGGACAACGCACGTGTCTCTGTGCTCCTTTGCTTGTTGTATGTTCTTGGCGCGAGGACTTGATGGCGACGCGACAGTCCTACCTCCTGGCCT
TTGTGGACGCAGACAAAGA