Description :
From Genome Similarity Track
Location :
Scaffold_41:491993- 493139
Transcript NameFunction/comments
Physo_135931cell 5A endo-1,4-betaglucanase

Sequence
1146 bases(100 bases per row)
CCTCAAGAATGAGCCGTACGAGGGCACCTGGGGCGACGGTGAGGACACTGACTGGCGTGAAGGTGCACAGACCATTGGAAACCGCATGCTCAAGGGCTGC
TCGAACTGGATGGGCTTCGTGGAGGGCATTTACGCCTCACACACACTCGCTGTCGACGACACCGAGTACAGTTTCTACGATTGGTACGGCAGTGGACTTC
AGAAGGCGAACGAGTATCCGGTGGAGTTTACCACAGAGAACAAGGTGGTGTACGCGCCTCACTACTACACACCAGGTACGAAAACTTTGGCTGTATATGG
GTATTCTTCGTTGACGCTAACATTATTCCTCTTCTTGCGTAAAATGTTTTAGCTGTATATCCACAAGCTTACTTATTCGGTGGAGGCACGAGCGGCGATA
ATGGCGAGCTGGACGACTACGTGGAGCTGTCGAATTCGTCGCTAAAGTCGCGAATTTCGGCCACGATGGACGAGATGTTCGGCTTTATTGCGGATAACAA
CTCGGCTGCTCTGCTACTGGGCGAGTTTGGTGGTTTGTACGCGACCGATTTGAACCCGGAGCTTACGACGAAGCGCTGCACCGATTACTCGATCGAGCTC
ATGGTGGAGAACGGTTGGGCGGGTGGCTTCGTGTGGTCCTTGAACCCGGAGAGTGCGTACCAGTACAACCCGTCCGACACGTACGGCACCTTTACCGAAG
GCGTGCTGGAGGACGACTGGTTGACGGCCAACAGCGAATTTTTGGCGGGCCTGGAGGCGATGAACGACCTGGAGCATCTGCGCATGATGCCGTGTTTTGA
GACGGAGGACTCGGACTCAGGCTCGTCCGGTTCAGACTAAAGGTTTTCAGGACCACTTAAGTTAAACTCGTTGCATAATAACACACCTCCGCAACTTTTG
TTTAGTACACGGAACCTTGTACGTCGCAAAACTACAATGCGTGACGTACGGAATACATGTAGAGCCAAGAGCGTGAGCGGGGTAATACAACTGGTAGAGG
AATATCTCAGTCGCGTTGCTCCGTTGAGTTGCTTAGGGGGGCGAATCACCACTGCAGGCTGACGTCCCCGCTCTATCTACGGTAATGAGCTGTCTAAGCA
TCACGTGTAGTAAGTAGTAAGGCATCAGAGTTGCAGCTACTCAAGT