Description :
From Genome Similarity Track
Location :
Scaffold_91:49177- 57196
Transcript NameFunction/comments
Physo_158217PREDICTED: similar to myotubularin-related protein 1
Physo_140883mucin-like protein

Sequence
8019 bases(100 bases per row)
GCTTGGGGTCGAAGTACGACTGCAGGATCTCAAAGTCCTGACTCATCGAGCCGCCGAGGAAGCAGCCCACGCCCGTGGTCGAAAACACCTTGGACTCGCT
GGCCCCTGGCGTGGCCGTGTCACCGTCGATGCACGAGGGTTGCAGCGTGGTGCGGCTCTCTCCGACGGGGGTCACACTCAGCAGCACTGCGTCCTCGTCG
TCCTCTTCCTCGTGCACCAACACGCCGTTCATCGTGTCGCTGTACACTTCGCCCTCGAGCAGTCGATGCAGCTGCGCGCTCTCGCGACGTAGCCTCTCCA
GCTCGCTCTGCAGGTCCGAGTTCTGCTCCACTTGACTCTGGAGTTGCTGGTGAGCGACGCTGAGCTGGTCCTGGAGCTCGCGCTGAGTGACTTGCAACTC
CTTCGCCCATGCGTCCTACAGGGAGCAACCAGTAATAGGCAAGAGTTGGATGAGTTGTTCAGGATAAAGGCCAATATGAGTGCACGCCGATCAGCAGAAC
ACCACACGACAGCGGACAGCACGCAACATGGAGGAAAGGGGACCTGATATACCCGAGAGTCATTCGATTCCAGCGCGCGCAGGTAGAACGCCGTCCAGAT
CGCCAGCGAGCTCGTGTGCCACTTGAACTGCAGCACTGTCGGAGATCTGTCGCTTGAGGCCTCGCCACGAAGCGGTACCATGTAGAAAGGATTTCGGAAG
TCGCCAGCCTGAGGGTGCGCTTCCAGTAACGTCCAGGCGCTCATGCATCGGATGACCGTCTTCGACCCCTAATAAACAACAAGACGGACGATGATGAGGA
CGCAGCGGGCACGGTAGTCACTATGATGCAATACTACGAACCATTCGCGCCTCCTCGCAGTCGTGCAGGAAGGTTCCGCTTCGCTTGTTGTAGACTTCGT
CGAGAAGTGCGATGAGATAGCGCTCGTTGAACTCGAAGGAGCATGGGAACTGGCGCATCAGTTGCCACACAGCATCCACGAACTGCATAAACACTGGGGA
CGTGTTGTCGTCCTCCCAGTACGCTGCTTGGGTGTCTGTGTGCCCCGATCGAGCGCGGAACTGGTGTCCAAATGCACACCACTCCTGCTCAATCAGCACC
TGAGTAAAGTGACATGACAGAGAGTATGACACTCGTAAGGGAACTTGTAAAGGCAATCATAGTAGTAGATCGAACTGTACCTGGAAGCCCTTGACTGTTC
GATAAAATGGATCTACGCACAGCTTGACCAGCGCTGTGATCTGAGCAGTGCGGTCCCATCCATCGGAGCAGTGGATCATCAAGCTGGTACCTTCCACGAG
CTTTGACACGCAAATGGAACACGACACCAAGACGGAGCGCACGTGCTCCAGCCATCTCGTGCTCTGGAATGATAGAATATATCATCGACGTTTGTTAGCT
GAAGATTGTACTTCAGACTATTCATCATGAAGACAACAGTAGACACGCACCTCAAGGCACGAAAGCCAGTTGGGCCGTTCGTTGCCGCGCACTTCGTTCT
TGATTAGATCGAAGAGCTTGCGGATCGAATCTCGCATCGAGTGAATGTTTTCGATACCCATGAACATGATGTTGGTATCCTTGTAGTAATCCAGCCTACC
ATCGCCAACACCGACAAAGCACTTGCAATGAGAAAAAAAACAACCAGCAACTACCACCACCACAACACCAACCACTCACACTTCAAACCCTCCGCCCAGC
GCGATATTCCCGTACGCACTGGTCTGACTTCGACAGTCGATAAACAACAGCTTCCCCTTGCACTCTCTTCGCAGTGCGGCCATGTAGGCTTCGTCCGAGG
TGCATCTCTTCCTCCTGAGACCCACAAGAGGCTGCGCACACCTCGCCACCACTGCATCATTCTTGTGTCGGTGCGTCACCGCCGGCACGCGCCCACGCGC
TCGAAAGAAACTGATTTTCCTCAACTCCCCATCCGACACGGAGGCGGGCACCACGAAGGCGCTGGGGTACGTCGGCGACATCTTGTAGCTATTGTTCACG
TGCGTAATCCGGAACCCTCCGATTTGTGCGCCGGTTTTCGGCGTCTTGAAGCCCAGTCGAGTGAACTCCGCCTGCGGGTCGTACGCCGCCCACCCCGACG
TGTCTGGCTGGCGAGCAAACGCATACGCAGCAGGCTGCAACTTGTCGATGAGCATCTGGTTGATCTTCACGTAAACGTCCCTAGACACGGCCTCTCCAGG
GAAGTTGAACTTGACCAGCTCAAAGTTTTTGCACGAAACTTCCAGCTGACTCATGGGACCCAGTTTGCCGTTCACCCGGAACTCAGCCAGCTCGGCAATG
TTGTTTAAGTGAACTTCCACTAACTCCTCGTGGTGTTGCTGCTACATACACAAAATGACAATATTTTCAGTAAGTAAAAAATCTTTAAAAATATCAGATG
AAGGTTAGAAAACTCACCTGGAAAGAGCGGAAGAGCAGTCTGTAGCTGGTGAGGAAGAGCGTTCCATGCATCACGTCGTCGTCGTCATCTTTAGAGGATT
TTTTGTTGCCAGTGACCCCTGCCACTCTCCCCAGAGTGGACTGGTCACACAGTGCGTGCACCTTAAAGTGCACGGTCTCGCCCATATAGAGGGCGCCCGC
GGGGTTTTCCATGACCAGATACATACTCTCTGACACGTACGACGTCTGCAACAGGCAACATGCAACAGCAACAGTTAAGCACCACTTAAATCGAAAATGA
CAAAAATTATTGGCACCGGAATTTCTGTTTTTCTCTCTCTTACTGCATGGTCGAGCTCCTGGCGCTCCACCTCCGTCCACGAGTCCTCCTCGACGCTGCG
TCGGCTGCTGAAGGACAGCGCTCCCTCCCCGCGCCTCGAAGTGGCACGCACTGCGCCGCCGAACATGATCTCTCTAACTGGTTAGCACTAGTCTAAACGT
GCTCTTGGGGTGCCCCTTGTTGCAGGGCGGGCCGTTTTTCTTCACTTTGTCGCTGCTTGGGTTTCTGATAAGGTCAGCTGGCCACGCTAAGTACGATTTG
TCATGCTGAACTTCTTCGATTGGCTGGTTACGGGCACTTCAACTTGGGGACAAATGTTGCCATGTTGGCCTACTGAGGGAGATATGCGTCCCCCATGGTC
GCGAGCGCGGCCTGCAGCTCCTCCGGTGCGTCAGGGCTCATACCGGCGCGCGTGAACTCGTACAGTGTGCGTTTGTCGCTCTTCTCCACCCTTTGCGCCA
ATGTCGACAGGTAGTTGCCGACCTCGGAGCTCGACGCCAATTGTGACACCGCGTCGATCGACGTGCCTGCCAATGACGGAAGGCGGTAGGTATCAGGCAA
CAGAAGCGGCGAAGCTTGGGACCATTGCAGCGTAATGTCGCGGGGTGACACGGGGAATCTGTCGATGGAGTGACGCAGGGACGGGGAGTTGGCGAAAGCT
CCTCGGAAGTGGAGGCGTCGGTAGTGCGTCTTGAAGCTGGGGTTTTCGTCGTCGAACTTGCGGGTGGTAAGCTGCGGGAGGACGGGGAGCAGCGAGCTAG
AGTAGAACGGGTCTTCAGTCGACGAGCTGCTGCGGCCGACTTCGGCTGTTGCGCTGTCGCTGATTCGCTGCAGGAGGGTGGTCGGGTCACTCGTGTGCGG
GAACGACGCGGCCAACTCGGCGATTTTCATGCTGGGTTGGAAGCCCTCCAGGATCTCGTTCACCGACCGCCCTCTGCTGCCTGGCATGGCGAGTTTCAGC
GCCGTGGCGACTACAGAGCTGACTTGGGCACAGTTCGACCGGTCAACTCTGAGCTGCGAGAACCGAGTGCTTGGCAAAGTGCTGGGCGACATCGCGACGG
GCACCAGGAGGCCGGAAATCTCCGACAGTAGCGCGACTGACGACGCCACGTTGATCCTCTTCCGTCCCTCGATCTTGGTGCGGTCGCGCACGTGCGGCGC
GACGCGAAACACCGCGTCGTCGTCGTCCGTAGCCATGGGGTAGCTCCAGTCGTTGCCCACCACCACAATCACCGCGCCGGGGCACTCCTCGGCAACGTAC
GTCATCATCTCGTGGGCCAGTCCGCCCCAGGATGAGTCCATGTCCACGAGGCCCTGCACGAGCCTCAGCTGGTCGCAGGACTCGAGCACCGCCCGCACGC
GGTCCTCGGCGTCCTCCAGCGTCGCGTTGCCGATGATTCCGCCGTTGGAGACGGCGTGGCCCTCGTAGAAATTGTGCAGCGGCATGTGCAGCCGGAACTC
GTCCACCTCCACGAGGTTCCGCTCATTGAGGCTGCCCCAGCTCCACAGTCCGTCCTGCTGTGACCCCGTCACGGGTTCAACCCCTGATTGGTCGTACACC
TGCACACCTCCACCCCTGCACAATAATAACAATAATAAGATGCATGGCAAATATGTGTTTCGTTAGAGAATAAATGAAAATATTGGTGCTTATCAAAACT
GATGTTTATTTCGTACCACGTTGCTGGGTCTTCCTGTTGCTGTGGCGTTGGTCGGAGCTGCCTGCGCACGCGGCCTTTGGCTTCGAACGCCAGCACATGG
GGCGTCTTGGAGCTCTCGTTGGCCTGCTGCAGCGCCAGCCACTGGGTGCCGATCGTCGTGGCGGCCGAGCCGAACTGCAGGCGCAACGTCTCCTCCTCCA
TTGCTGCGTGATGTGATGGGGTTTACGTACGCCACACCATTGTCTTTTATTGCTGACACATGGCTACTTAAGTACATTTTTCTAAGAATGCAACTTTTTA
GGCAAGTCACAGTGAAGCGATTCCGCTGGTGGAGACTTACTTTTACCGAGTGTCAAGAACTTGCCATGGTCGAGCTCCGTCGTTGCTCAAGACGTGTTGG
AAATAACGGGTCAAGGCCTCAGACTGCAGCGAGTTCGGACATTCGACTGTACACAGTAATCGCTATCGGCCCCTCGTTTGGACCCAGAAGCTGCAGTTCT
CGCACTGCGCGGCGCTTGCTGGTCGTGTGAGAAGCAACCTGCGTCGATGGTATGGTGCCGACTTCCGCCAGCTTGAGAGAGAGAGATCCATCCACCCATT
CGCCACCGCCATGATCGACTTACGGCGAGAGTTTGTTGCCGTTTCGCCGCCTGGTCACAATTCCGGCCTCCAGCGCAGTACGCGTGGGTGCAAGTGTTTG
AAGCGATTACACGCCAGGAGAAAGCCACATCTAAATGAGCTCCCAGATGGCGCTGAGGCACTACCGGTAGATGTGCGTGTCGTCGTGCCCTCTTGGATCC
ATCGTTTCGGCCAGCACACACACGACGGGAGGAGGAAGACGGACCGATTGAAATGTGTGGAGAATAAATCACTGGATGCGGATCTCACCACGTACGCTGC
GACAGCGACAACGCTACGTCGTGCAATGCGGTGGCCAAGTGCTTCACGCAAGGGCGCTGGCGCTCGCGGGCATCGATTCCGAGCCAACATCTTGGTGATC
CCCGTTTGGGGTTGTGCCCGGTTAAGACCTACCATGCGCTTTTCCTCTCGCTGCCAATACTGTACCACGGATAGCCTACAGTGTTGTCGATGCGTTATCC
CAAGAACTTCTTTGGGCCGTCCCGCCACACGAACGCTCTGAAATGTGAACCCGACACTAACGGGACTTGCGGTGGGAGACCATATCGAGTTAATCCGTGT
GTCACGTCGAGACTTGAGGACAGGCGGCACGTACGAGGAGGCACAGTGGGGGACAATGAATGTGCTGTTCGCAGAGCTCAGCGTACTTCCGTGGCGACCA
ATGATTCTCTGGACTTGCCTGCGCTTCTTGCCATGGAGAGAGAGAGAGAGATCGCGCCTCCGACGCCAAGTGATCGGTCGATCGATCGATTCTGGCCGAG
CCGAGCAAAGTCTCATTCCCCAATTTGCCAGTTCGACTCAACATCTTGAGTACCACCAACCTCCAATCAATCTCGACACCATGGTCCGCGTCTTGAAGCC
GTTCAGCGTCGTCCTCGCGACGGCGCTCTCGCTCGGTCTTGCGGCCGCTGCTGACCCCACCGTCTCGGTCCTGGGCGACGCGACCTACACGATCCCCGAG
TCCCGCGGAGTCATCTGCATCGGCTCCGGTGACGTCCCGACTGGAACGGCCTGCCCTCTGAAGGGCGACGTCGCGTCCGAAGCCTGCCGCGAGGGTATCC
CTTCGTACAACGGCGGCGAGTGCGTCGCGCCCAAGGACGCTCAGTGCGTCATCGTCACGGGCACGACCTGGGGCTGCGCGTTCCCGGGGGAGGGGGAAGA
GACGCCCTACCAGAGCGTGGAGCAGACTTCGTCGTGCGCCGGTGAGACTGAGGCGCCGTACCAGCAGACCGCGTCGTCCACGTCCGGCTCGTGCGGTGAC
GATGTCCCCGAGGTGACGTACCCGGACCAGGACGAGGTGACGTTCCCCTCCGGCTACGGCAGCTCGGAGGCTGCGACGCCGTACCCCACGAAGGGCACCA
CCGACTACCCCGTTGACCAGGCCACCGACTACCCGGTTGACCAGGCCACCGACTACCCGGTTGACCAGGCCACCGACTACCCGGTTGACCAGGCCACCGA
CTACCCGGTTGACCAGGCCACCCCGTGCCCGACTCTCCCTTACGCCTACGAAGGAGAGCAGAGCTACGGGAACCAGGACACGCCGTGTCCGACGCTGCCC
TACAGGTACAACACCGGAGGCGAGAGCTACCCCACTCAGGACACCCCGTGCCCGACGTTCACGCTTCCTGGCGGTGACTACACGCAGACCGGCGGCGACA
ACACCCAGAACGGTGGTGACTACACGCAGAACGGTGGCAGCTACACCCAGAACGGTGGTGACTACAACCAGAACGGTGGCAGCTACACCCAGAACGGTGG
TGACTACCAGCAGACTGGCAACGGCTACCAGCAGGGGACAGGCGGTGACTACACCCAGAACGGCAACGAGGGTGGTGCCTACAACCAGGGCAACGCCAAT
GGCGGTGACTACACCCAGGGCAGCCAGACTGGCAACGCCAATGGCGGTGACTACAACCAGGGCACGAACGAGGGCGGCGACTACACCCAGCAGGGGAACA
GCCACATTTACGACCACGAGGGAAGCTACAACAACGGCGGCAAGCAGACCCAGGGCGGTAACTATGGCCACCAGGGATCTGGCAACTACGGCCACGAGGG
CGGCTACCAGCAGGGAACGCAGGCCCCGTGCTCCTCGTCGAAGGACAATGGTGACTACCAGCAGCACAATGGCGACTACCTCCACGGTGGCAAGCAGGGC
TACGAGGGCAGCCACGCCTCCACCTACGATGGACAGCACAGCCACGATGGCTACGTCCAGCAAAGCTATAGCAACAGCGATGCCAGCGACTCGGTGGACA
CCCCCTGCTCTTCCTCGAAGGACCACGACGGCAAGTACGACCACGATGCCGAGCACTCTCACGGCGGCGAGTACGGCCATGGCAGCACTTCCGTTGATGG
TTCGTCGTCGCAGGGCTATGAGGGCAGCCACCACGGCGGTGACTACCACCACGGCGGCAAGCAGGGCTACGAAGGAAGCCACGGACATGACGACAAGTAC
AACCACGACGGGAAGCAGGGCTACGAGGGAAGCCACGCCAGCGGCTCTGTGGACGCTCCGTGCTCGTCGTCGAAGGACTACGAGGGAAGCCACGGACATG
GCAGCAAGTACGAGGGCAGCCACAGCCACGGCGGCGAGTACGGCCATGACAGCACTTCTCTGGATGACTCGTCGTCGCACGACTACGAGGGCAGCCACGG
CGGCAAGTACGGCCACCAAGGAAGCAACCAGCACGGCGGTGAGTACGGCCACGACAGCACCTCCCTGGATGACTCGTCGTCGCACGACTACGAGGGCAGC
CACGGCGGCAAGTACGGCCACCAAGGAAGCAACCAGCACGGCGGTGAGTACGGCCACGACAGCACCTCCCTGGATGACTCGTCGTCGAAGGCTTACGAGG
GCAGTCACCGTCACGGAGGCAAGTACGAGCACGATGGCAAGCATGGCTACGAAGGCAGCCTCTCGAGCGGCTCTGTAGATGCTCCGTGCTCGTCGTCGAA
GGACTATGAGGGCAGCCAC