Description :
From Genome Similarity Track
Location :
Scaffold_14:4917- 19931
Transcript NameFunction/comments
Phymu_g991hypothetical protein
Phymu_g992hypothetical protein
Phymu_g993conserved hypothetical protein
Phymu_g994hypothetical protein PHYSODRAFT_284561
Phymu_g995hypothetical protein

Sequence
15014 bases(100 bases per row)
TACCAACGACCGCGGCCGCCACCGTAGCCTCCAcggccacgaccaccgccgccgccgcgaCCAACAAGGTCGCGCAGCTCACGCGGCACCTCCTGTTCAG
CTTCCTCCATGATCTTCACCAGAGGTCCAGCCAGTCGACTGTTGTTACCAGCGGTGAAGAAAGAAATGGACGTACCCTTGTTGCCAGCACGGGCCGTACG
ACCGATACGGTGAATGTAGTCTTCGATATTCTTCGGCATGTCAAAGTTCACCACGTAGCGGATGTCCTTGATATCCAAACCACGTGAAGCCACATCCGTG
GCAACCAAGATCTGCGTCCTGCCATCCTTGAACTCGCGCAAAACATAGTCACGCTCCTCCTGCGACTTGTTACCGTGAATGGCCTTGCACATGTAGCGGG
TGTTGCGCAAGTTGCGACTCAGCTCATCAGCGCCACGCTTGGTCTCACAGAAAATGATAATACGGCCGCCCTCGTAGATGTCACGCAGGTGGTCCTGTAG
CGCAGAGTATTTCTGATGGTCATCCATCACCTCCACAATCTGCTTAATCCGCTTGTTAGCAGTCAGGTCCAGGGAGCCCACTGTCACCTGGATAAAGTCC
GTCAGGAAGTCGTTGGCAAGGGTCACGATCTCCTTCGGCCACGTCGCCGACCACATCAGAGTCTGACGGTCAGGGCGGATCTGGCTTACGATCTTGCGCA
ACTGAGGCTCGAAACCCATATCCAGCATGCGATCAGCCTCATCCAACACCAGATAGGTCACACGGCGCAAGTTCGTTTTGCCCATGCTCAGCATGTCAAT
CATACGGCCAGgcgtgcagatgcagattTCCACACCACGACGTAGGTCAGCGATCTGGCCGCCCTTGGGGACACCACCGTACACGCACGTGTTCTTGATC
TTCGAACTAGCACCGAACTTGTTGCACTCCGCTTGGATCTGCACGGCCAGCTCACGCGTCGGAGCAATCATCAGCACAATCGGTCCGTCGCCAGGCTGAA
GGTAAGGCTACATTATGCACAGCACAATAAAACAAAGTTAGCTATGTAGTAAAACCACGAGGCAAGCAGGGTTGCACGAGAAAGCAAACACAAGCGAGCT
CCGAGGGATTTATAGGTGTTCGCATGGTGCTTTTTCTTCTGGCCATCGCCCACAACGCACCAATGCAGTTTTCGCACCGATCGATCGTCAGcgaaagaag
aaaaaagcCATCTGAAAGTGTCAGTTGTGCCGGACCAATCTGTCGAAGTAAGTCGGTGGTGCTCTTTCCTTACATGCGTGTTGCAATGCAATATTTTCCA
GAAATAGAGGCTGGTTCCACCAACTCGACCGGCACTCCAACACTGCAGACTGCGACCCGAATCAACTGAAGTGACGAAAGACACGTAAATGGCGCCAATG
GAGCTTTCCCCACAAGCGCGCACCTACGTGAATCGACCACGCTCTGAAGACCGTTGTAAACCCCACGTCTCTCGCGTGTGCATCTCGTTCAGCGCATCAC
AAAAATTGTGCGAGAACGACCATTGTGTGATCAACACAATTTTGCAATCAACCTCCATCAGCGCGCCAACGCTGCGGAAGATGTGTCCACCAACGAAAAA
AATCCCCTCAAAAGAGTCTGCTGCAAAATACGAACCTGTGCGTTAATGTGCACGATCGCAGGTAGCAAGAACGCCAGAGTCTTGCCCGAACCCGTCGCTG
AAATTCCCACCATGTCACGTCCCGAAAGAGCCATCGGCCAGCCCTGGCACTGGATAGGCGTAGGTTTGTCAAAGCCAAGACgcaccacctcctccagcac
atATTCCGGGAAAGAAGCCTCCTCGAACGACAAAACGCACTTAGGCACTCCCTTTCCGGACACGATAATCTGGTTTTCGCGCTTCCACTGCTCGTACTCC
TCCTCCGAGCGCTTGCTCACATCCGGATGCTCGTAGTAGAAGTTCTTTTCAAAAACTGGCAGCTTAGAGAGGTCCCACTGGATGTGCGTGTCCAAGTTGG
ATCCCAggtcgccgccgccgccgaaaccaccaccgccacggcctcctccgccgtagccgcctccacctccatagccgccaccgccacctccgccgtagcc
gcctccgccacctccgtagccgcctccgccaccactgtagccgccgcctccaccgcgAGAGCCTCCTCCATAGCCTCCGCTGTAGCCTCCGCCGCTGCTA
CCGCCGTAATCACGACGTGAGGAAGAGTCGCCGTATCTgtcaccgccgccgccgtacATGAtcaagagtgatggtccttGGGTCGCTTGCGCACTACAGA
TCGTTTTAGCGAATGGTGACAGAGTGCAGCCCTGGGCGACAGGGCAGAGAAGTCATCGCTTTGGGCAGGGAACGTTAAACAGGCGCTTTTGGTTGGCTGC
CGGGACAGCGGAATTTCAAGCAATCAGATTGAGAATCCGATGCAGAGGACGTTGATTGGGTGAAAACAAGGGCAAGAATGCAAATTTGGATCGAAGGGCA
TGAGCCCGTTGTATTGTGCGTTGTCTGGTGacaggagcagaagacgtgGGACGGGGTCTTTGCCTCTTTCCGCAGTGGATGGTATGGTGGTTCTGTGGCC
AAAAAGACTGGGTGGGGATCCCGTTCTATAAAAGCCTTCTACGCGATAATGGTGCGCTCGTACGAGGCAAACTGCTGGTTGGCCTCTGAGATGCTCACTT
CGATTTTCCGCACGCCGCGCTCCTGCAGTTGTAAAACGCTGACGTTAATAGACAGAACTCAAGCCATGGTGATGTATGGGCATAGCTTTTCTTACCAGTA
GCGCAACGAGCGTGAAGGAGTCAATAAGCTGGTTGCTCTGTAAATGAGGAGAAAGGAAGCGACGTCAGCATCGCCATCGTACAAACGATGAAGTAATTGC
AGGCACGTACGATGTAAATGGCCAGTTCCTCGGCCGATGAGTGCACGATCGGAAGTAGTGAGCAATCTGCCTTGGGGAAGCTGAATTTCGCCATGTCTTC
CGTCAGAATATGGACATTCGTGCCATCAAACGAAATCTGCGGTTAATGCGTACCAAGTCAGTACCCTACAGCAGATAGCGATCACCATGCGCATCCTTAC
CTTTAGAGAATCGCTGTTCATTGGCACTAGGAACGATTCGTTCAGGTCTTTGCAAATGACCCGCGAGATCTTCTTGATTTCACCAAAGTCCACCACGTAT
CCATCCGGGCCTACCTGGCCGGTGATCGTGACGGCCAAGCGGTAGTTATGGCCGTGGAGCTTCTCACGGAAACCCTACGTGCATGCAAGCGTTAAACACC
CCACTTACTGCAAGTACACATACAATAATGATGCGTACCTTGTACGCAATGAAGTGGGCAGCGTTAAACTTCATGTAATCCTTGGACACGTGGACCTTGA
ACACCTCGTTGTAGCCGTTGCTCATGCGGTTGGGTGCGGGCACTCCGTGTGTTGCCGGGGCTGGCACTGCTGCCacagttgctgctgctgctgcaggtgc
aggtgcaggtgcaggcGCCGCATTAACCTCAACAGAACTATCGCCCTCCCTCGATTTCGACGTTGTCTGCACCACTTGGGCGCCGCTGGTTTGGGCGCCC
CGGAACGGCTGGATCTGCATTTTAATCTCTTCTGGAGTCTTGACACAGCCGCGCAGGTGCGACGCCCAACGGTCCACGTTGCGAGACGTGATCTCCTTTT
CACAGTAGCAGCACTTGACTGCGTCGGAGCTGCGCGACACGTACATCTTGACGATGGCCTTCTGCTCAGCGGTGAGTTCTTTGGTCATGGTAGATCCAGA
GGGATTGCGTCTGCGTCTCTTGGTCTCCGGTGTGGCCTGCTGCTCGCCGATCCTCGTGTGTTCCTCGTCAACTGACAGCATCGGGTCAAGAGCTACTGGA
CGCTCTCCGCCGACATGAAAAACGATGCTGAAGCGGTTTTGATTGGCAGAAAGGAATATATGGTGTATGTTACACAGTCTCAAAGATTGAAAAAGGCGAA
ACAATGACACTCGAGAGTGAAAATATATAAGGATGCGTGCGTTGCCAGCAATTTCAAGCAGTGCTTCACTTGCACGCAACTTGTGTGCGGCACGCTGGCG
ACGACGCCCTATTGGTCTGAGACAGCACGTGGCACCACactgaggaagaagttcaTGCTCACGCCGAGCAGCAGACCAACTTTCTGCTTGCGAGGGACGG
AGcgatcgagaagctggtgTAAGGAGAAACGAAAAATCACAGTTAGAAGCAAACCTAAAGgcgttggcagcagcagtagatGAGATGCACTCACCATCAG
AAGCATAAAtacaccaagaaggaggcccATTAGGAACCCCCAGAGAAATTCAGTGCCAGTGCCTTCGTTATCAGCTGCGAGAATCGAGTTGTTCATGCCG
TTCATGTCGATTTGCGTGTCCATCGCAATACGTGCCGTCGGAACAACATTGAGAGCTGTAAAAAGCAATCGCATAAGCAGACACGTTAGTCATTCTGAAA
CATACCACAAGCGAAATGCCTCGAACAGGTTCATACCAAACTCGGACTGCGGGCCTTGTGACGCCATCCACTCCTCCTCTAGTCGGTATATCCGGTCTTC
GCTACTTTCCCCAGGAACGCGATCCGCCTGGCTGATATACACCGAGAGCTGCGGGTAGAAATACAGACGCAGcgcctggatctcctccCGACTTAGTCGG
TCACGGAGCCTATCGAAGCCTCTCCTCGCGGCTGGGTCATCTCTCTCCTCTGGTTCACTCTCTGTAGCTGCCATCTACAGTACAAATTCACCGTTAGGTA
CTGCGAATATAAACGTCTCCACGGAAACAACAATTCATCTCACCTGGTTCACCACAGCTTTGGGCGGTGCCGAGCTGATGGCGCAATGGATAAAGTCCTC
ATTCTTGACTTTGCAGCTCGCAAGTGTTGCCTTGTCGTCCGACAGCATTTTGCCCTGGTGAATAAGCCGCAGAAACTTGCCCTCTGCATTagctttcttc
ttcacgagATCCTTGAGCTCCCCCACACTGGCCGAGGACGCGATCTCCACACGAAGCGGCTTCTCACTGAGGGTTTTGACCTTCAGCACAATCTTGCCAT
TGTTGTCTTCATTGATCGTGATGCCCACGGAATCTTCTGACAactaaaaacaaaaaacaaaatagTCGGATTGATTAAAATTCGCTATTTTCTTCAGCAA
AAAACGCGTAGAAAGCAGAGCACCTACCAGCGGCTTCTCCTCCGTGATGTTCTCGGTGTGCTCAGGCTCCATCATACTGCTCAGGTCGATCGATAGGGCG
AATACACGCCGCTCCGACCGCTCAGCGCCCTCTTCCTCTGCGCTGCTTTTTAGCTGTGCCGGTTTATTCTCGCCCGCGGATAGGGGTTACTCGAGCCAGT
TGGATCTCTAGTTTACGATTGGAGAAAAAGATCGATTCTTTTTTAGCCAATCCGACGAGTCAAAGCTATTACACCGCCAATTTCAAACAGCGTGTGTCAA
TGGAGAGCAACGTGCAGGTGGCTGTGCGAGTGCGGCCATTGAGTGCTATTGAGACGGATCAAGGCTCGGAAGCGTGCGTAGATGTGGTGGATTCCAGCGT
CTTATTGGCtgagaagcagttcgactTCGAGGCGGCGTTTCCAGCCACAacgcagcaggtgcagcgccAGCAAATTGGATTCTGTGTATTCATTTTTAAT
TGCTCGTTGCAATTGCTGTAGGAGAATGTATATTCTACGTTAGTGGCGCCGATGCTTAAACAGTTCTTCGATGGCTACAACGCCACGGTGTTCGCCTATG
GACAGACGGGATCCGGCAAGACGTAAGTACTAGGCactactactactgtagtacttAATTGTGGATTGGAGTGCGTTGGAGGTTCGCTAATATGGTTGAT
GCTGCAGATATACGATGGGCAATGAGTTCGCATCCAATGTGGCTTCAACTGAGCTCGGTGTCATTCCACGCGTTATTGAAAATGTAATTTGACTGATTGT
TAGATAGTGTTGTGTGGGGTGTCAaggttgaagttgacagATCTTGATATACGTGTGCAGATTTTTAAGCGGGTTAGCGCATCCCCAAATCCGCAGCATT
TTGTGATTAAGTTGTCCTACTTAGAGGTACGTTGCTATAGATCGTGATGTGACTCCTTGACGCTAATTCAACTTTGGCCGCAGATCCTGAACGAAGAAAT
CCATGACCTACTAGCAAAACCATTGCCTGGATCACTGCTGGTTAGCACGGGGCTATCTATACGTGGtgatggagatcgtggaATTGTTGTGGCTGGACTT
AGTGAGTACATTGTGAATTCGACGGACCAAGCTGGAGAACTCTTGAGCGCTGGAGCCTTGGCACGtgccacagcttcgactaGTATGAACGCCCAGTCCA
GTCGCTCGCACGCTATTTGTACCATTGTCATGGAGCAACATGACGtccgagctgcagaaggaggcaCCGAAACGCGGTTTTCAAAGTTTCATTTGGTGGA
TTTGGCGGGATCTGAAAGGGTCCGCCGCACCAACTCAGAAGGAGCACGCTTTAAAGAGGGCGTCAACATTAATCGCGGGTTGCTCGCGCTTGGGAATGTT
ATTAACGCATTGTGTGAACGCCGACACACCAGTTCATCGACAGCTCATATTCCCTACCGAGACTCAAAGTTGACACGTTTGCTCCAGGATAGTCTGGGTG
GGAACAGCAAGACGCTGATGATCGCGTGCATCAGTCCAGCTGACGTCAACTATGAGGAGACCTCAAACACACTGCGGTATGCATCTCGAACGCGGAAGAT
TGAAAACCAGGCAGTGATTAACAAGGAACGAAGCGCAGAGAACGAGGTTATTTACTTAAAGCAACAAGTTGAGATCCTACAACTGcaactcctccagcac
acACAAGACATGGCAAGTGGCCCAAGTAGTATGGGTGGTCATCGCCCGAATAATCTGAAAGAGGAGAATCACAGGCTTAAAGAAGAGCTTCTCATCGCAA
ACGGTGCCATGGCCAAGTGGGGAAAGGTGACAAATGGGCCGGTAGGCAAGAATAAGAACGTGAACGGAGAGGCAAAGGCAATAGTGGGCAAACCGCCATC
AATATCGACGTCAAAAGGCAATGAGAAGGGTAAGGGCGACAAAGGTCTATCGCGGTTGGAGCAACTTCGGAAGTTTCAAAGCCAGAAATTGAAATCTGTC
AGCACGAAGGCAAGTCCTGCTTTGAAGCGACGGACTGATGGCACCACGATACCAAACAAGCGCAGCCGGACGCCAGATACTAAAGGCATGGTTGGAGGCC
CAGACACTCTCCCCATTGGTGCCACGACAAAGCTGTTGCAACAGGTAATAAAGTCTCGGGAGGCAGTCTCTAGTGCGAAGGAGGCGGTCCGGACCAACGT
TGCAGATAGGAAAACTTTGGCGCTGGAAATTTCACGATTAGAGACTTTGTCGGTGGTTGAAAATGCTGAGAAGCTGGCCACGTTGCGGGATGAACTTCGT
ATAAAGACGGGTAGCATCCGTATTTTGCAGCAGAAATTGGCCAACATCGAGGAAACGATGCCCCTACCCTTGGGGCTCTTTCCTGGTAAGGTTGATGTTT
GCCATGATCTGATTCGGCATTTGATTCAAACACTGGTGAAAAGTAAGGAAGAGTGGACGAACTGCAACGTGGAGCTTAAAGCCGCCAATGAGGAGATCGA
GAGACTGATGATGGAGTTGCAGAAGCAAGCAACAAAGAGGAAAACAACTAAGAAGCGGAAACAACGGCAGTCGTATGAAACTATGGAGACGCTGTTCAGC
AgtagtgaagaagaagatgacaaCAGCGCAGACTCGGATTACGTGGATGATGAGGACCGTCGTGCGAGAAGAACCAAGCGAAAAAGAGGCGCTAGCACCC
CATCGAACGTAACGAAAAGTGCGGATGTTATGGATGAATTCAACGAGGTACTGGAAAGCAGtgccgcttcctgctgctcttgtcaCGGCAAATGTGCAAC
GAAGGCATGCGCTTGCAAGGCGCAAAGTCGAGTCTGTAGCGACGAGTGCTCCTGCAATTCAAAGAAATGCCAGAATCAAAGTCGTGAAGATTCCCCTGGC
GATTCTCCAAGTGAAAGTCTGAAAAACAGCGAAACAACTGGTGAACTGGACAGTTCAACTCCAAATGGAGTTGAATCACAGAACTTGACTGGCACCAAAG
CTTTTGGTACGACAGCCGGGATTGGTTTGATGTCACCTTGATCGTACGATGCTAACACGTTAAACTTAACGAGGTTTTAAATCATGTATTTAGCTTTTAC
CACTTCGGATGAGCACTTCGTTTACTTGACAGGCAAGGTAGTGCTTTATGACAAGCCCTCGAAGAGGTCCATGTCTAAAGcttccgtcttctccgtcatG
AAGTCGgtgtcgtcctcgtcgtccgtgtcggAGGAGGCATGGTGACGCGCCGCGGCCTTTTCAGCACGACGAGTTGGTGTGCGGATGCTGACACCGTTCG
AGTttttgccgttgctgctccCGACGCTTCCAGTTTCTTTGTGCTCACtcgtccttgatctcgtTCGAATGACCAGTGCGGCTTCCTTGGGCTTCTGGTA
GTGGTAAGTGTTACTGTTACTGGATGAGTATTTCGCGCGCAGCGCTCGGGTCTTCTCTTCACTCTTCTTTGCCAAGAAACCTTGGATGAGCTGGCGCTCG
TGGTTGTTCATGTACGCCAGTTGCACACTCGTATCAACGACCAGGAAAAGCTCCTGGTATTCCGATTCCTGGCGTGTAAAAGCAGAAGCGGGCGAGAAAG
AATACGAAACCACTTCGAGGATATCGATCGAGTCGCGATGATACGGAATGTGCGCGAAGGCCAAACGTTCTGCGGGAATCGATAaagcagcactggcagc
atCCGCCAGATAGGTATCGGGGTGGTTTTCTTCCTCCAAAGTGGAAATGATCACCTCATGCCGCATGTTCTTGACAAAACGCCACGTTGCACGGTTTACA
TAGGCGAACTCGACAATTCGGTGGTTAACCTCGGTCGTCTCCGGCTCGGACAAGAGCTCAGCCACAATGCTCCTCCCTTCATACACAGCCAGCTTGGATG
CTTCCACGAGCTTTTGTCCATCCACTAGCACACTGGTCATCGTACTTTGGCGCAAATCACGCAAGCGGATGTGAGATAGAGTTACCTTGTCGTCTTCTgg
ctgcacgagcttcttctccaccagctcattCCACACCTTCCTACGAATATCCTCCACCAACATTTCTTCACTGATGACCACTTGGCTCACGAATGTCAGC
AACGAGTCGTCCTTCCCAGTTGACACTAACACCTCATCAATGTCAAATTTATCGTCTGCATTCGTCACAGTAGTCTGGTCCTGGTTGCCTCTGTCACCGT
TCTCTGGGGAATCCGAATCAGCCTTTGTCGGGTTATAGAACATCAGGCGGAAGTTGTACTCGCCAGTGTTCAACGGTGTCCCCTCCAGAGCGAAGACCGT
GTGGTTCGAGCCAATCGACAGTTTCGATAGAGTGCTGTCTATCGCCTTGATTTCCACGCCGGCACTGTTAATGCCACGCAACAGCTTGAATTTGTTAGAC
GGGAGACCAATCTTGACACTAACCTGCTCCTTTAGTGTGCGGATCGTTTCCCTTCGATCAATGCGAATTGGCTCCGCTGGGCTGGTCAGGTACTTGAAGT
TGACCGTGATCATGTTCGCCTCACGCTCGAAAAACGCCTCAGCCGGCGAAGGAAGTGCCAGATCAGCAGTTTCCTCGAAATACAGCTCCGTTCCATTCAC
CAGGTGCAGATCCATCTTCAGCCGCAAGTTCAGCgtccgttcttcttcgtttgCATTGAGGATCTTGGCCGCAGCTATGCTGTATGTGGTTGcgctcttc
ttgatgagGCGAATCTTATGGCCTGCCCGAAccgagaacttcttcgcgATCACAGCGCACAGCAATGCAACATTCGCGTCGTCATCCACCTGAACGCACC
TCGCCACGAACGAGTTTTGACTGGTGCTGCCTGCCTCTGGGTCGACAAAGCGACGGATAAAAAGCTGCAATTTTGTCGGATCATGCTCTTCCCACTCTTC
GTCAGTACTTTTAACCTCAAGGAACATCTGGTGGCCAGCGTAAACCCCCAGCGACGAGAGAGTCATATCCTCCTTGTCCGTGTACGTGTCCGATAGCAGG
CAGTTGTAGTCATTGTAGCCTCGCAGTCTCACGTTCTCTATCGACGGGATAATGAcatccttctccttcgcgaATTCCTTGTAGGCTGTTTCGAGTGCTT
CCCGGATAGTTGCAGTTTTGTAGATGTGGATAGCCTTCTCTATGTTTTTCGGCTTGGATCCTTTCATGAAGAACTTCAGCTGCACCTTCTTTGCCATTTC
AATGCGTTCCTGTTCCAACCTACGAATCTTTTCCTCGTCAGCGTGGATCCTGTCTTTCAAATACTGCGGAATGCTCTCCGGCAAAATCACGTTAACATTC
TTGTCAGCGTTAACCAAACGATACAGCAGCATGTACGCGCAAGTGCTGTAACGCATGCTGTATCCAGAACCACTTGCACCTCCGAATGCAGTCTTCAGTT
CGGTGTCTGAAATCTCGCTCACAGTGGAGTCGTTAAAGTTGTACCATTTGCCAGACTCTAGAGATTTAATGTACGCGTAGTAGTGGCCACCCAGCGCACT
GCCAGAATGGATCAGAACCGAGTACAGCTCGTACACGTGGGGCCCTGACCGCTTGATCATGACCTCCGGGTCGAAAGTTGGGCTCCACGTGTCAAATGTA
GCGGTTCCGTCtacatcatcttcatcatcgtcctcctTTTCATCATCTTTCTCGAATGTCACAGGCTGTGACTCGTCCATGGACGACAAACGACGTATAC
GCTCACCCATAGCGGCAAGCCCCGGcgttggaggaggtgaagcaggtGTAGCTGCTGGCACTATATCCTCTTGCGAGGTGTGATGGTTCTTACCTTCCAG
TACGTGACGCTCCATTGACATTTTTCGTGCGATCTTACCACGAACGCCGCCATTTTCATCACTCAAGTACGAGTTCATGTCCAGATACTTCGGGAACGTA
ACCTTATTGTGCAATTTGATGCGATTCATGGTGGCATAGTCAAAATCGAAGcgtttgagctgcagcatcaaaATGTACGGCAGCTTGGAAAACTTGAGTC
CCTTAATAGCGTCTCGTTTCACCTTGCACTTGTCACACATCCACTGGTTCTCCTTGTTCAGCACTTCCGGCCTCAAAAACAGCTCAATCGCTtcctccac
cgtcttcatcatctctGTGGAGCCAAAGGGGCGAATAACCAGCGATAAATCCAGAAAATTGTCAATCCTCGAGCTTTCATAGCCACAGTCACAGCACTGC
ACGTAATCCTTCAGCGATCCTTGGTACAGATCATTCACGAGCGTCTCGTTCACCGTGCCTTTAAAAGATTTCtccaaagcgtccagcagAACTCTACAGA
GCTCCTGTACATCATGTTGCTGGAACACGTCAGCTCCTGTCCATCCAAAGCTCTTGGTCAGCGCTTTAGTGGAAATCGAGTCTTTTGTTGTCAGCTGCAA
CTTGGCGAAGAGGTTCTGCAGTTGCAACGGGATATTAtcttcatccgcttcttcctcctcgtcttcctctttgtcctcctgctcctctgCCTTCTTAACA
GCTCGATGGCACGTCCAATCGTACAGTCCCTGGCGGAACTCAGGCGTCATGAACATGCTCTGCAGCAGACTGTTCATGTAGCACGTAGCTCCTTGATTGG
ACAGGCCCGTAAAGACCTTCTTAGAGAAACTGTAGCCCCCAGAGCTGCCATAGCTGCTGCCTCCATTGCTCGTGTAGCCTGGAGAGTCGTAAATGCCCTC
CAGACCCGAAGAGCTGTACGTTGTAAGCGCTGTGGACTGCACACTGGGGCTTGTGGCCGATTGCGCACtttcgtcctcttcttgaGACGCGCGAGGCAAC
TGTGTCAACACGTTCGCCACCTGCGCGCGGTGCTGGTCGCGAGAGGCCGAGAGgtcgtcgtcatcgctcgATTCCCAGCCCGAGGGCGTCGCTACATATT
TATCCCCAGAACTTGACGCGGGCCAGTCGTTCGAATCCCAATTCGAGACAGACGTTGAATCCGTACGATGAGGCACAGACGCAGACTGCCAGTCGCCGTT
GTTCGAGTCTCTGGTTGAGGTCGCTGAAGCCTTGggtggatctggacgctgtgctgtAGGTGCGGGCCTTCCGTCGCTCATACTTGATCACTAGAGAGGG
AGTTCTACCTACTGAGATCTATAGACAAGGGAGGGTATATGGTGTAGTGCACATCAACAAATATAGATGAAAGTGGTGGGTGGTCCTTCCTAGAATTCCA
GGATGggtttaaaaaaaatgtgCAAAACAGTGGTGAATTTAGATAACATCGCTGGGTGTGGGTGGACTTTGATAAGGTTCGAGACTCTACACCATACGCG
GCGTGGGGGACATGTTCTTTGCGAGCGGCAGTTCCTCGTCGGAGTCTTCAGAGCCGTAGTAGGCACGGTCGCGCTTGAGAGTGAAGGTGTCAGAGAGGAA
GTCCAGCTCACCTGAGCGAAGTTTCTCTTTTCGCCACATGGTGTAGCAAAAGACCATTGCAACAGCGTACAGCATAGCTAAAGTGGATAAAAAATATCAT
TCAATTCATCAAGCAAAGACAGCAATAAATAACACAAGAGATTAGAAGCTGTACATCAATCAGCCGACACACTTGAATTGAAATCATGCTTCTCTGCTGT
AGTGACGTACCTGCCTCAAAGCACGAGTTGGCGCCGGAATTGGGAGTCTTGGCGTTGAGGATGTACatcggctgcagcttcagcaacgatCCCACAACTA
CCTGCGAATGTACACACAACATATACCAATAACACTGTTAACAAGCGCAGCATGTCGCCGCAGCGGGGGTGGCGGCCGACAAGGTCACATCAGCGTACCA
GGAAGACGAATCcaacgaagctgaagatggtGCCGCATAAATAACCTTCAGGAGGCAAGTCGAGCATCCATAGTcagaagagaagcaggagaatTAACCA
AGCGCCTTCGAACTGCTCTTTAGCCTCATCCTATCCACGTACCCCCTCCACTCATGCCTGTCTAATGTCGGTGTGCTGTGTCCTTCCTCGCCTGAATTGA
CGTCAATCCAGATGCTTCCGCCCCTAGAAGTATTAACCAATCAAATGTAGGATATGTTCACTGAAACAATTTGTGGCAAACACCATTTCAGTGTGACTTC
TACATTAGCGTGGCAGACACCAATAAGTTTACGTCAACGTGGCGATTGTCTTATCATTCGCCTGACAGTCTCCaattgccattgccattgtCATGGGCGT
CGACAGAAAGCTGCGTGTGCTGTGCATGCACGGATACCGCACGAATGCTAAGATCATCGAGGACCAGACGCGTGGATTACGCAAGGCGTTGGCGCCACAC
GCCGAGTTTATCTTCCTGAATGGCCCCATCGAGGCCCGCGGACCGTCAGACGATGTGATTGAAAAGCTGTACGCCGAGCACAAGCCCTTCTACGAGTGGG
GCAGCTTCACTGAGCGCGAGAGACCGCACCGCCTCGACCCGGAGTCCCAGGAGATCGAGTATCTGGACGGTGGCTGGTACCACGACTACGTGGACTGGGA
CAACACGGTCAAGTAcatggacgagcagctcccgAAACTCGGACCCATTGACGCCGTCGTGGGGTTCTCACAGGGCGCGCAGACAATGACGGCGCTTACA
ATGTGGTACCTGCACCATCACAACAAACGCTGGTGGAATTGCTGCGTAAGTGTATGCGGTCCACGCGTGCGTGGGGCGGCACTGCGCCCTCTGTTCGAGA
ACCCTGATGGAACGAAGAAGTTAGTGCCGATGCCGTCTATCCACATCGTTGGGAAGACGGACAAGTGGCGCAGCGGCTGCTACGAAATGGTCGACATGTA
CGAAGATCACCCCAAGGGGGCAGCGCGCGACAAATTCGTCTTTGAGCACGACACGGGACACCGATTCCCGACTGGAGAACGGCACGAACAGCTTTACGAC
GAAGTGGCGCAGATCATTCGCTCGCACTGCGAGTCCCAGACGGCGAATGCACGAATTGCGTGAGGTACCGTAGATTCTAACAAAGTAAATCCTGCTGGCT
CATCACCtcacgttgaagaagacgttcacTTTTCACGTTAAAAAACGCAAACAGCCTCTTCAGTTCCAGATTTGCAGACAAAGTGACATTGCTACTGTCT
ACCGTGTACTGTAGTATGACGGTCATAGAGAAGAAGTTGCGTGTTCTGTGTCTTCACGGGTATCGCACCAACGTAAAAGTGATGCAAGACCAAACGCGAG
ACCTGCGTCGCGTCATGGCCCCCCACGCAGACTTTGTGTTTGCTGCGGCTCCGTTTGAAGCTCGCGGGCCTTCTGACGAGGTGGTCGAGCGGCTTTACAG
CGATCATGGCCCGTTCTTCGAGTGGGGCCACATTACGAAGGTTGCTCGCCAACATGACAGCAGTGACAACGGGTGGTATCACCGGTACGTTGGGTTCGAC
CGGGTCGTGAAACACATCGACAAGCAGATACGAGACCATGGGCCGTTCGACGCCGCTATCGGCTTTTCACAGGGTGGGCAAATGCTCACGGCCTTGACGA
TGTGGTACTTGAACCAGCGCAGTGAACGCTACTGGAAATGTTGCCTCATTTGCTCGGGAACACGCGTGCGAGACGTCGGTTTGCGTCCGCTATTCGAACA
CTCGGACGGCTCGCAAAAGCCTGTGCCGATCCCTTCTATTCACCTCATTGGCAGGAAGGATCAGTTCTACAACACTTGCCGCGAGCATGCAGAGCTGTAT
GCTGACAGCCCAAATAAATGGGTGTTCGAGCACGACAGCGGTCACCGCTTCCCCTCTGGTGATCGCCACCCTGGTCTTTACGAGAAGATATCCGACAAGA
TTCAACAGCACTGC