Description :
From Genome Similarity Track
Location :
Scaffold_24:49169- 70219
Transcript NameFunction/comments
Phyta_totarag1327hypothetical protein
Phyta_totarag1328hypothetical protein PHYSODRAFT_506421
Phyta_totarag1329hypothetical protein PHYSODRAFT_560624
Phyta_totarag1330hypothetical protein PHYSODRAFT_508787
Phyta_totarag1331hypothetical protein
Phyta_totarag1332conserved hypothetical protein
Phyta_totarag1333hypothetical protein

Sequence
21050 bases(100 bases per row)
ttgaagacgaTCGCATTACTTCACGCTTGTACTGAGCACGTACACCTGGcatggtgtacatgtacatgtacattatGCCGCAGCTCAACATAGTCGCCAG
TTGAAGATGAAATCGAGccgaaatggctacaaacCCTGTATTTTCATGTCCGCTGCAGTTCATTGTAACTAGTGctcagcagccagcagcgcctcacTGT
CGAGcgcgtcctcgtccagcacgagcgacacccttctcttcttggcgttTGTGTGGTTCAGGATGGATCCGTTCTGGTAGTCAACCACATTGAGGGCGAT
GCCCACGAGGCTGCCCAGCACCCCAAACgacacaaacagcagctccacaccaGGAATATACCGGTCGTCGTGGTTGAATTCAGCCGCCACGGCCAGCGGG
AACAGCGCGAGCCCGATGTTCTAAAAAGATATGCACAAAACAAATAAAAAAAAGTGGATAGGTTAGATCAAGTGCATAACCTTCTGGAACGGGTCCACCC
TGAACAGCAAGAAATCTAGGGCGACGCTACCCGAACGGGGTACGCACCTGGATGGCAGTGATCGCTCCGTACGCCGTTCCGACGTGCTTAGCCTCGACCA
CGTCTGTATAGACACAGCCAGATACATCCTTAGTACTTCATAACCAACTGCCCGAGAGCTTCTACCCAGCACTTACATGGAACGGAGGGCCACAAGGCTG
CGGCGAACACACTGTAGGCAACACCttgcagcaccaacggcACGTAAAGTGTTACTTGAGTCAGTCCGAGCATGACGTGGACTGCCGTCAGTGCGAGCGG
ggccaccagcgccaacaaGGCGCGGAGACCGATACGGTCGACCACGAATCCGAGGAACGGAGATATGACGGCGCTGATAATGTATGGGGTAGACATCGGG
GTAGCAGCCTTCTGAGCCGCGTCCGTTTTCGTGGCACAGTACGTCTTTGTCAGGGGCCCAAGTTTCCATGCCTCGTCGTCGCAATTAATCCTGTCGCCAA
TAATCAGTGGGGGCGAAGTCGAGCAGTTCCACTGGTCCAGTGGTTCATTAATCGTGCAATTCACCGACAGCAGGGGGAGCGGCCATCCGTAGGGAGGAAC
ACTAGGGCACCCCGGAACGATCTGTTGGCAATCGATTTCATGAATGTAAAGTCCCTCTCCGCATCGTCGGCACAGCTCGGGGGGCTCCTTGAAGAAATCA
CGCTCCATCAAGAGACTACTAGCGACGTTGTTGAAGGGGATCACACAGCCGTAGAccaccaagcagctcaacgcCAGGAGCCAAAAGGCCGGGCGGAAAT
GTTTGACGTCACTGAAGTGAATGCTCTCAGCAGCCGCTCCTCCCTCTTTCTGGTTCTCTTTCGCCAACTTCTCAGCTCGTTTATCAATCGGAATCACAAG
CAACACCGTGAAAGTGGATGCGATGCACATGATAACACCCACCCACAGCGCCGCCGACACACTTGACGCTTGGGCGACAACTGGACTCAGTTCGTTATTG
ATGACGCTTCCCAGTCGAGCTACACTAAGGTTGATGCCCAAAGCCAATGCTAGCTCACTGTTCTTGAACCACGAGGCGACGAGCGTCCCCTGAGCCACTC
CCAAGCTTTCTCCACCGAAACCAAACACCACTCGGCCGAACTGCGACACAAAAAGAATCGTTAGCCTCATTTAACTTAACATCAATGGACCACGTTTGCC
TCACCAAcatcatgttgaagctggagagcgagcagCCCGTTGCAAAGATCAATTGCCCCGTTAGAATCGCCGTCGAGAAAGCGAACAGCATCACACGCGC
ACCGAATCGATCGACCAATACACCGCCAAAGAATGGCAGCAAGATGTTGGGGGTCGAGTACAATGTGTACAGCAAGTTCTACAGTGAGATACGTTTACCA
CAATAATTAATTTCCGTCATTCGTAACAAATTGTACTGTTGGTATTCTTTTCTAAAGTTATGCTAGAAAATGCTGGAATAACGTAAAGATCGGAACGTAC
GAAGAGGAACTCGTAGCGGTCTTTGGGgatgttgttgaagtgctgctgcagctgactCTTGAGCGCCGCCGGGTTGTCGAAGCAGTAGTAGTTACCGATC
ATCAGTACACAGgacaggaacagcaccagccaTCGCACGCGCAGTTCGCACTTCTCCATGATGCTGGGGGAGAAGGGTGCGGATACAATCTGACTCAGGC
CGTCTGAGAAAATAGAACCGAATATATTCATGTAAGTACGAGTTGAAGTAACCATCACTCTTCTATCTACTTTAACGTCGGGAGATGTTGATCGCGCATG
GCGTCCCAGCGAGCGATATGCTTGCTAGAGTCTTGTGGCGGGGGCTTCACTTGGTACACGGCGCCTAGTGAGCAGATGCCGTCTACGTCTCGAGTCCCGA
AGAAGCCGCAGACGTAGCTCCGAGCACTCTTTGGGCCCACGAGAGAAGTCAGCGACCCCGACTCTGCGCTGCCAAACCACTGGGTAGTACGCCGTGTAGT
TACGAAGCGGAGTCCAAGTACTGCAGAGGGAGAGTGACATACGTCCACGCGTTGGATCCGCTCATCTGCGATTAATTCGAGCAGATGCTCGTTCGGGCCA
AGGGCATCCTCGCGGTCTTTCAGATAGCGAGCGTACTGTTCGCcggtgatgatggagatAGCTCGTAAGCGGACATCACACGTGATAGCGATCCCCTGAA
GTCCAGCGTGGCTGTATAAGAAGGATTTCCCACTGATGCCAGCTTCCCTGATAGAGACTGGCTCCGCCTTCGTCTGTTGCTCATTCAAAGACACTCGAAT
GTGGTCAATTCGCGAAGATCGCGCGAGCAGATCGAACCTGCACCCCAGTTGATTGCAATGCTGACTGGTGTGAGACCCGAACAAACTGCATATGTAGTAT
CCTCGAGGGGCCGCTATTTCATCCAGCTCGTAGCGATCACTGTTGTGCCACTCGCCTTGGCCACCAAACCACTGCGACGATCTCAGGTTTGTGCATATTT
TCAGCGAAACAATCACATCAGCCATCGTCCGAATGTCGAGCCGCTCGATGTACTCGTTTTCCATCAGTACAAACGTATGCCGTAGTCCGCGTGAATACAC
AAGGGCCGGCACTAAATCGCACCGGAATACGCATCCTACCGCGATAACATTCTTGGCCGCATCTATCAGCACCGCTCCCAAGTCGTACACCTCGTTCTGC
CATCGGCGACCGAACTCAACTTGACCAGCACATTCGCGACCAATTGCTCTTGATAAAATTGATTTCGTTGTAGACTTCACATGGTGTGCCATGCCCGTTG
GGGTCATTTCAGGGAAATTCTTCGATCCTGGGCTTGTGATAACTTGTTTCATCGTGACTCCAATTTAATAATGACCGGGATTTGTCTACAAAGGGTGTCG
CCACTTTATACTTTTTTTTACGACAGATTGCACTCGATTTGCTGTGTCTCTGAAATTGGACTACTCATCAAGCATGAAAGTAGCATATTCGCTTCGGAGT
GGGTGGGTGATTGTTGATTGTTGCCGACATTGCAATAGCTTTTGCTTTTTCCGCCACCACTTTTGGATGGTTGTGGCGTATGCATTATTCCACATGAGTG
TTAGGATCTCCTGGCGTCGCTGATCCTCCAGTCGGCCCTTCAATTCGTAAAACCGAGCTCGAGCCTGCTTGGCTCGATACGCATTCTGCAGCAATACAGC
GGCATTCGTTTTTCTTTGTACAGCATTTTCCACGCGCATCCCAATGCAGCTAATGAACCGAGTGTATCGGAAAAAGTTGAACAGCACCCGCTTTGCTTTT
GCTAGTTTATCGCGCTTTGctttggcagcagcaatccGTGCTCTTGTTCGGCGCATCCAAGTCTGAATGGAGATCGCTGCGTGATACCGTGTCAGATGAT
GGCGCCAAGCAAGAACGTCCCCCTTTTTCTCAATGTAGCGTACAATAGCACGCGTAATTACACGCGATGCTCGTTGTTGCTTCATCCAAACTGCACACCG
CAGTCGAAAAAGGTAAGATCCATAGACACGCTGGACTTGATGGGCAGCCACATTGTACGCTAAGAAGCGTTTTTTTCGCTTGAACATCCTTCTAGAATGA
AATCCTCGCCAACCAGCTTGGATAAGTGTCGCGGCATGATGCAGGTGGTGGACAGCTGCTGTCCGTTTACCTCTCACACCGCGTATCCAACTTTGAATgg
ctactgcagcagcaatagctTCATCTTTACGTTGACGAGctgtgctcgtcgtccatcgGCCCCACACGCGAAACACTACACACTCGAGTCTCTTGCGTGA
TCTCTGGAGAACCCATAGCGCACATTTCCTATTAGCAAAGACAACAAATTAGACACATCTACGGGATTGAAAATCACAAATTAGCTGTAAACGCACAGGC
GGCAAAACCTGCGGACCTGCTGGTTGCATTGTATCCACGTCGTTTGCTGGCGCCAGTGAGCAAACCTCCGGCGCTTGGCTTGGTAGCAATGTCGGGACAC
GACGATCTAAACATTAATGAACAATATATGTACGTTTGTAGGAGACTGGAATTGCAGATCAGACTTAACGTAGTTCGTACCGATAGTTTTTCAACTGCAA
ATTGCTTTCTTGTGGCCATGGAGCGAGTAACCTCTTCCATGCAATGGTCGCGGACCCATTCACGAATTTCGAGTGGGCAGGCTTCCAACTTTGGAGTTGC
AGACGACTTAGGCGCAGCGAGAACATTATGCGGTTTGATTGGTATCCTGGTTTGCTTTTGCGGTAGTTTTGCTCGTGCTGGCACTCGTTTACACACGATC
ACTTCTGGGAGCATCGCACTGTTTGTATGCACAATTGGTAATGCTCGACTGCGAATCCACGTATTTCGCGCGAGCTTATCACATAATGAAGTGGGTGGTG
CCTTAGGGGAATGAGCCTTGACCCACTCTTCTTGCCGACGAAGCATGACAAGGGCCATCTCCAGTTCCATAACTTGATCATACGTTAGATCCACTCCTCG
CAGAAAGCTAGCACTCTCTAGCGTGCTAGCGACATTTGAATGTGTAAGCAAGAATAGCACATCCTCCACCGCCAAACACCTTAGACGGAACTTGTCCTCC
CAGAGTGAAAGTACGTGCTCACGAAAGCTGTTGGCTGGTGCGTGCAAGCCCGTGCTTTTATCAGATGGTATGGCGAGAGCTTGATTTGTAGTTGCACCAA
CCAGTGGCAGTGCAACTGAAGAACGTGCAGACACGAAGGTCGTTCGAAATGGCCCTACAGATCCGTTGCGCTTGTTCCTGCCATCTAAACCATTCAGCAC
CTTGCGCTTTCTGTTGTCAAAAGTTTTGGGAGCCAGCATACGTCTTGCCTCGCAAAGATTCCTTTGCTCCGGCAAAATCTCGTCTAAGATATTTGCCACA
CTCCAGTTTGCCCCATTAAGAGCAGCGAGACGCCCAATCAAGGTGGCGAAACCTACAACAACCAGATAGGACGTGTGTCAGCAAGTAGGGATACCTGAAT
GCCAAGCTTGTCATTTCATTCTGACGGGGAATACCTGCTTCACGATTCCTGCTACCATCACTAAACGCATCAAGACCCGCTTGTCGTTTCTGCATCTGTA
GCAATTTTGTGGTCTCTTGCTGATTCAGTTGTCAGGAAATGGTCTGGACTCCCAGCTAATTTTGGTTTTTCATTCATTCAAATCAACGCGCAAGTTCAGA
TCCTTTGCCTCCATAAAATCGAGAAGTTCCTGGCATTCATCTTCACTCAAATAAGCACGCATCACGCGTAACCCATCCATGTAAAGTGCCTTGCTCCATG
CACAGGCTGCAATTCCACGGTATAACACCTTTTTCGCCGCATCCACCTTTCCGAGCGCTACCTCGAAGTGCATGTACAATCCCCAGCAGAGCGCGTTGTC
TTTGGTCCGAATCTGATTCACCATACTTTCAAATATTTGCCGGATACGAGTAATTGCAGTCGTATTCATACCCCAGTTATGAAAAAGGCAGCATGTTGCA
CGGGAGGGTTTGTCGTCGTTGGTCGACTGCGCAGTCTCTGATAATTCCTGGATCGTCGCGGCTCGCTCAATGCGGCAAAATTCACAGAGCAGTGCGAATA
ACCACTCCACCAATTTCGGTGAATCATAATGCCGTCGCGAGCGATTTTCAACCTGAAGGAAGTAGTTGCGAAGTACCTGTGAGATCGTGTTTCCCGTCTC
GGAGTCGACAAAGAGCCGAAGAAATAATTCGTTGTACGGAAATTTCTCCACTGCCCCACCGATTGACGAGCGCCATACACGGGGCGCAACTGTAGGGAAG
AAACCTGAcacttgatgctgctgcatgaatTCCAGAAAGCAAGTCCACATCCATGCTAACTGCGAGCAGGTCTGATGCTCTACGTTGGCCAACGCCTCGC
GATATTCTTGGCAAGCTGCCTCAAATCCGTGATAGGCGTACACGACGAGTGCCAAGTTGTGCAAGCAGTAACCAGCCCAGCAATCTGATCGGTAATGTGA
TCTACGCATTGTTTTGCAACCCTCATGACCTCGCGTAGTAGATCTGGCGCAATGCTGAAGTGCAATGCCGAGCTCCGCTCGATATCTAGCAACGAGATTT
GTTCCTGTCAACGGATCGGACATTAAGAGCTTCTGCAAGTATTCGTGAGCCCGTTTTCGATGTTTTTTCGCGATCGTGCCCAGTgtttccttctccttgc
cgTCTAATTGCACAGGTTGCCACACATTCCACAGTGTATACAAACACCGCAACAGACGGTGGTCCCCGTGGTCACAAGCCTTCTTTTGATCACCGATGGA
AGACCACATCTCTAGCCGCGCGTGAAGAAAAGCAGAGCGATGGATAATTCTAGCCAACGAGGCATTGTTTGAGGATGGAGCACCGAGTGACTTGAGCGTA
TTCTCGCAGATCCGTCGTACTTGACGTTCATTTCCCAGAGTaagctccagcttggcgtaggcgtgaagaacagcaaaatCTGTATCGCCGTTCGCAGACT
TTTGGGCTAGGTTCTGACTTAAACGCCGGGCGTGCGCTAAACTTTCCGCTTGTCCGCTGGCTGTACGTGTAACCTCAGCTTCGAAGCCAATCCAGAGGCA
TTTTAGTATACTTCCGAAATTCACATCAGTATTGTGGAAGATATCCAATGCTTGTGCAAAGACTCTACGCACAAATGCCACCTTGCTAGGGTCACGTAGC
ACACCTTGCTTCACTGCAACGTCACCAAGAAGGGAATTCTCGAGCAGCATCTTTCGATCGCACGGATCAAGAAACAACGTATGCTTTCTGGAATCGTTTG
CTTGAGGGTTAAGTGCAGATTGAATTGGAgcctcaagcagctcgtaATCTTCACGGCTGTCTGCATACATTGACTCGCAAACGGGAAGGCTAGTCTCCCA
TGAATACTCGCCACGCCAATCTACGCCACAGATATGTAGCAACTCAGCAATAAGCCGCCATCGGTGTGCCACCGGAACAGAAAACAAAAATGGCTGGATT
TCTTCCGTCAGTGTGGCACGGTCCGGTTGCTGCTCAATAAGGCCTTGGTGTAGAGGGTTGCTACACTGCAGCGGGGCCCATTGCAATTGTGTCTGTACTT
CTTCGCGCATCAGCCATTGCACAAAGTGGTCATCTTCTTTAACCGGATCATAGTTCGCACGTTGATCTTCTACTTGCAattttgttgctgcaagcACTGC
ATGTTTCAGCTTTTCATTTTCAAGTAATTGAGTTtgtcgagcacgagcactTTCCGTACCGCGTAACTCGCTTAGAATGCGCTCGTACTCCCTCGTatcg
tcagcttcatcaaTGTTAATGCGGTACCCATGCAAGTTGCTGTAGATAAGCGTGCTGTCCCGTCTGGATTCCATATCCGAGTCATCACTTGCTGCAGAGT
TTGCTGGATTTGAGTCGAGGtcgttttttttctttttgcTATCCGCAGTTTTTGCTTTTTCTTTTGTGCGTGACTGCCGTTGATATACTGCAGAAGCGGA
CAACAGATTCTGCTTGTGCTCTTTAGAGCGCAATACTTCAGGAGGGTTCATTTGGTCGACAGTGGTAACACAAGTTTTCTGGATGTAGTCTTCGAACTCA
GCGGCAGAAAGTTTAGGAGGATCTTCTTCCAATATTCTAGTGCTCGAACCAGTTTTATCCCCCCGCTCGTCACCAAATCTCACCGCATCATCATCATTCC
ACCGTGAAGCAAACTTTCGCAACATTTCCAAATGTGTTTCTTTGGTGCCACTCCTAGCAACCATGACAGTCTCGTTCAGGCTGAAATCTAGTAGAGCTTG
GAGCTGAGCGATTGAGCGTTCGACATAGCCTGCCTTTTTCTCAAATACGCACATGAGGAAGTGAAAATCGAGTAGCACTACCGACAACTCCTCCCCTTGT
GTGGCAAGTGATCTTGCCTCAGTCTTTTCACTCGAGTTTGAAGCCGAGGGTGATGGTttagtcgtcgtcgctgtctcATTCACATCGCTTGCGCTTTCCG
CTCTCAAAACTGCCAGTATACGCGCGTACAAATCGCGCACAGACTGCATCGAGAAGGTACCAAAGTGTTGGTGCCGACTTTGAAGTAGCTTGAACCATAG
CTCGCTGTTCGTCAGATCTTCAGCGAGGAGACTCTCCAGCTGCCGCTGAAACGAGTCGACATCACTGCTTTCAACGTTCCTTTGAGATTGCAACGACATG
TTTAGCTTCGCGCGATGCAGCTCCCGTGATTGAGGATTACTGGCGAGCGCTCTTGCTAGAATTGCCGTTTGCTTTTCCACGACGCTTGCTTTCATGGCTG
AACTCGTCTTTTTGGTCTTGGTGTGGAGGCGCATTGTCTGCTCCTGGAAGGCCATCAAATCAAGCCAATTGTTAATGATATGTGGGCTcgcggcgacagc
agcattgaACCTTTTGCTGCGTTCCACGATATGCTGTTCCACACTTTGTCCGTCGGTTAGCAGAGGGGTATGGTCGCGCATCTCATCCATATCACCATTG
ACGTCAAGCACCGGGTCAAGCGGAATGAATGCCATTTCGGGTGGATAGCTCATGACCATATTAGCGGTCTGGTCGGGTTGGTTGCTGTGATCCACTTCGG
TGTTAGCTGCCGCGCGAGATAATCTTTTCTCCGAGTAGGCAAGATACAGACGCTTCTGTCGACCGTCTCTCTCCATTTTGCGTGCCTGCAGCGAGAAATA
TCGATCCGAGTCTTGCTTTTCTTCCTGCTTGCCAGGCATTTTGTTGCTGGTATATTTTGGCCGTGCATGAGATATCCATGCACCTGTGACCAGGTTCCGT
CGTGTAGCCAACTGGTAGAGCGGCTGATCAGGGACATACGCCGATCCGAAGAACCGATTGTCGCGGTCACCGGCGCAGTCGAATTCAAAAAGTTTATCCT
CCTCATCTGCCGCTACTTGCCCATgaaccacaacaacagcagacTGTTTTACGATCTGGATCTCTTGCTTACAGCTGCGCGACCGAGATCGAGACCGGGA
GCGCGaattgctgcggctgcgcCGTCGGCTCCGTCGAGAACGGTGACTAGAGCGGTGAGtatcgtcatcaccactgCTATCGGATGGACTCCGCGACCTG
cgtcgcttcttgctcttgctcttcttcttgtgtttAGAGAGATGACGAGTGTCACGTGACGTCACGGCTGACTCCTCACTGCGTCGGTTCTTTTCCTTgt
gttttttcttctctttGTGGCGATGTTTACCATGCCGATGTTTGTGTATTTGCAATGCAGACACAGACGACTCGGTTGCATTTTGCTTCGCTTTATCGTC
GCTCTGGCCAGAGGAAAAACTCTTGCCAATACTCAGCCAATCTAAGGCACAAGGACACGCAAGAGTTAGTGCGATATCATGGACACCTGCCAACAACTCA
TTAGCATACCGCCAGCAGTCTGCACATTGCCGCTttgttctgcagcgacgtcctGAGACGAACTCGTCTGCCGACCTGCTGCAAACATGCCGCGGATGAA
TGTGGTCTCAATAACAatgactaccggtagtcaaAATATAGTCCGCCGAAAACGGTGATTGATCAAAATATAGTCCAGAATACAGAAGCAACGTGATTCG
CTGCCTAATTTATTAAATTCATGGAGGTAGTTCCATGCGCACATTTGAAAGTGCAGAGCATGAAGCGTTCCCCGTCTAAATCAATTTCAATTTAGGGATG
CTTTTGTGAAGTTATAAGATACAGGGAGGGCAAAAAATATGAGGGTCGAGTCTCCACACACCTACCGTAAGTTACTCACTTCGACACCCAGCGTGTCAAC
TATGAGCGGCGAGAAGCTCGCAACACACACGCCGCCCTTGGACCTGATgaacgaggaggaggtcTCTGCGTACATTAAACAGAAGATCCGCGTGTTCAGC
AACTTTCCCAAGCCCGGCGCGGATTTTAGCGATGTcacgtcgctgttgctggaccATGTGGCCTTCCAAGTGGTCATCGACGCCCTCAAGCTCCGGTATG
CGGACCAGCGGATCACCCACGTGGTAAGCTGCGAGTCCAGAGGGTTTATCTTCGGCGCGCCGTTGGCGTTGGCTCTCCAGGCTGCTTTTGTGCCGGTGCG
TCGCGCCCGGAGACTCCCAGGAGACGTTGTGGGCGTGGACTACGTGTCGGGCTTCTACACTGGCCGCATGGAGATTCACCAGGACGCCATCACGAACGGG
GGCCGCGTTGTCATCATCGATGATCTGGTCGCATCGGTGCGGCCGtttgtgtagccatcttgtGTTTTTTCGGTAGTCGCATAAGAACTCATTAaagatg
ctgttgttgtttgCCAGGGCAACACACTCAAGGTCACGGTCGAGCTCGTTGAAAAGCTCGGCGGAGAAGTGGTGGAGTGCGGCTGCGTGATCAACTCGCT
GCGTTCGGCGGtgcgttgctgtcgaacTGCCTAGCGCTGACTTGTGTGCTACTGCCGCCGCCACTAACTGACCACTGGCTTCGCGTGTAATGAATGTCTT
TCAGGAATCGCTGCAGAACATCCCGTTGTACGGCCTCACGAAGATGTGAGCGTTAGAGTgcatgctacatgtagctagAGCTTAGCCGCAGAGTGGCATT
TGAACGGGGCGACATCGACCCGCAGCGTGGCCATCTCACATCGCGAACCTGTCTTTATTGATACCGTCTAAAACGATATTTTCAATTGCAAAGAATTCAA
CTGAGTGAAGATACAACCATGAAACAGACTCTGTGATTATCATGGAACCTGCGATCTCGCATATGCGAACAACGAGGCTTTTAGAAGACCCCAGATTCTG
GCGTTTcggaagcgcttgctggAATCAAAAAACGAAAAAAGCACGAAGGGAGAAGGTACCCTACCTACCCGTGTGTCTGCAGCTATGCCTCCGAAGCAAC
GTATCCGCCAGCGCTTCGGGCCCAGCCAGGACTATCTTCTGGTTGTGCAGGTGAACACGGACCTGCCGTTCCGCGCGCCATACGGAGGACTCATGGCCGG
CTGGGAGAAGGTCGCCACGACCCTCAACGGCTGCAGTGCCTTCAAGATGCACCACCTCAAGGGACCTATCGCCAAGAACCGCTTCGAGCGCCTCGTGGGA
CGCCACCgcagctggatgaagaaCGGTAGCCACCCAGACAACGCGCCGTCGCAGGACGCTGCCTTCCAGAGCGTCATGACCGAGCTGGTGCCCAAGCTGG
ACGCCGCGGAGGCGGAGCCGCTAACCCATACACTGGGCAAGCGCGGCCGCCCCCGGAAGATCCGGTCGGAGGATGGACTGGCCCCCCCAGAGAAGAAGCC
ATCGCTAGTAGCCGCGCAGGTGGCTATTGCTCCATCCCCATTGGGGCCGCagccttcttcgacgaccTCTCTTCTTGTGGATTCCGAGGACCAGGCGTTG
CCCATTATTACCAAGGCCACCCGCCAACGGTTCACTCCTGGAGACGACCTCTTGCTCGTCAAGTATGTGAAGGAGTCGCTGCCGTTCCGTGCCAAGTTTG
GTGCGATTTCTGCGGCATGGGAAGACGTGGCGTACAAATTGGACAACAGTCCGGAGTTCTCGAAGGATAACATTAAAGGCCCAATTGTGCGCTACCGCTT
TGAGAATCTGGTGTCCAAGTACCGTGAGCGCGTCAAACGCAACAGCGGACGCGTTGTGGGACCGAAGGGTGCTCCAGCGGGTGAACTTGAAGTGCTGATG
ACAGAATTagtgacgctgctggacggtgGGGACCCTGTCAGCGCTGCTCTGCTTGCGCAGAACGTGGCAATCGCCACTGGTGCAGTCAGTGCAGTGGCAG
TACGAGAGGTTCCTCGCACATCTACGAGCCAGGATGAGGATTCAACCAGTAGCACTAGCGAGCCATCGTCGCCGGTCTCCACTACCTCTGAAGTCGCCTC
AGCCGCGACCCAGAGCTTCATCACCCCTACGCCTGACCCCGAGCCGACGACGGTGCCAACGTCAACGAAACCGGCGACGATCTCTCCTGTGTTGAATGGC
ACTGACCCCACAAGCATCGCTGAGCTTAAGGCCCTGCTTCAAGAAATGGTGGAGCAACAGACTCGGGCCACagagcagatgctgctgctgcagcgcgaag
agcGCCGCCTGGAGGCTAAGCGGCGAGAGCGggagctcgagctcgagcgcgaggagcgcgagaaggacCGCCAGGCGCTGACTGCCACGGTGATgtcggc
gatgaagacgttTCTGGAGCAGAACAATTGCAAGAACTGAGTGACAATGATGTAGTTCGTAAAAGGGCGCTATGATTTTAGCAATATCTCTTTAGCACAT
ACCGGGCTGTCATTACCCGCGTCTATTAAGACCACGCACATGCGAGCAGCATGTGTGAACCTGAACATCGGCGTCAACTTCCTTCGAAGTCTATCTACGT
GACGATTTGCCTGACAGACGACAGCTGGGATCAGGTCTTTCTTTCCCTCAGGCCACACTTCTGAAGAACGTCTCTAATCGCATCGAGGAAGCGAGAATTG
AATATGCCAGACAACGCCGGCTCATGCTTCGCAGGCACTTGCTGTGCAACGTGTGGCGCCGGCGAAGGAACCTCCGCGAATGACAGCAACCGCCGACGCC
TTGCCGGCGATGACCCGCGCCGCCGCGTCTACGATACATCGCGCGATGTGACCGTGCAGCCCGTGGTGATGTCACAGATCCGCGCGCCGCAGCCCCAAGT
GCGCGCCAACGACTAAAGGAGGCAtccaagtacatgtatgccgCAACGAAGGAGTCTTCGCAGAAGGACTGCACGACGCCAGATACTGTACTAACTTGAA
GTGGCGAGCTGTCTTTGGAAATGGCTACGAaccaggaagaagcagcacatcTGCGATAACGAATAAACTCCATTGCCCGCGGACAAGGCATCCTCATGCA
CAAAATGCATTGCCGCTAGCCGGCGGATTATGATACGTCCGACGTGGGTAAATAAATTGCTCGACCATCAACCGCAGATTTCGGCGCGTTTCTGCTGAAG
GTTCGTTCTCAATTGCTGAGACACAACCATCTTACAATTTTCAAGTGTGCACACGTCACATGATTGCTAGAAATGAAAGCCTAGAATGGCTACTGCTCAC
GGCAGTGCCGTGAGAGATCTCATTGCAAGAATTGCTGGCAGAGCAGCAAgccaagaagcccaagagATAAAGCTGAAAGCCAACCGACCAACTTAAGAAG
CTCTCGGGAGAAAGACAACTATGTGCGGACCAGACGACGGATGCGATGTATGCTGCATGGACGACTGCTGCGGGTGCTTGGCAGGTATGTGCTGTGCCTC
GTGCTGTCTTGCTAGCGCGTCAGCGGCAGACAACGGCGaccgacgtggacgaggtggcTATGATTCGCCGCGAGAAGTGTACGTTCAACCAGTGGCTGTT
CAGCAAGGCTACGGACCCCCGCCTCCAGGATACggaccaccacctccaggaTACggaccaccacctccaggaTATGGACCGCCACCTCCGGAGGCTCCAC
CGCGCCGTGACTACTACTATTAATCTACTCAAGGTAGTCCAAGTACACACAGTGTATGAACACTTCGGGTGAAGCTAGCGAAGACCTCACTTTCGCAACG
AGCGTACTGTCCTGTTGGAGATAAAGTAAATAAAAAAAGTTAGTTCAAACGATTGAAGTGACAGTCTCAGATCTTGGAATCAGATCCCGAAGAGCGGAGA
GGAGGAATCTGCTGCAAAGTATCATGGGAGGTAAGACCGTGGTGGGCACGCGGCTCCATTGGCACAGCCACTCGCAGCATGAGCgcatcgacgtcgacaa
gGTGCTAGGCCAAGTGCGTGCTTTCTGCTCTCGCGCGGCCACGTACTCCGACGGCGGAATTCTGATTGCTGTGGGGCTGCCTGAGGCAATTGCCGGATCC
ATCACAGCCGCTCGTTCATCGGATGGAGATGCATCAACGaccagcgccttcatcgaCTCCGTGCGCGAGTTCATGACCCAATTGCAGAGCGAAGTGACTG
CAGGAACCCTTGCTGGCAAGGTGGAGATTATCCCCATGCTCCATTGGGGGAAGTTCGTGCCGGCCCTGAATGCGTTGATCGGAACGGCCGCCGACCACTT
CCCCAAGGCCAACACACTTCtcttgcagtcgctggagatCGATGTGGACGCAGCTAGCGTGAATTCGCTGCGCTCGCATTTTGACCTCACGCGCGATCTT
GTGGTGGGAGCGGCGCTGCCTGGCCACGACTTCCAGCCGGGTCCTGAGAGCCAACCGATCGAGTTGAGCGGCTTGACGTCGCCGTGGAACACGCTCGCGC
TGTGGAACCTGGAGCAACTGACGAAGGTGGGGTTTGCACTGATGGGAGACGCATTGCGCCTTGAGGTCGACGAGATCGGCTCTGCCGCAGGCATCGAAGA
AGTCGCCACCATCGCAATGTACCAGCAACTCTACATGAACACTACATCACCTACGACGGCCAAACTGGTGCGAGTGCCTAGCATCGCGTGGCAAGTGGAC
GGACTAAAGGATCCCAAGCGTCTCGCGTGGCAtgagaagaagatggcgagcaagcagcaacgcgcaGCTGCACAGATCGTCCACTTCGGTGGCGTGGCCC
CAGGCTGCGTGTATCACTTGGACGCTTGAAGTTGGAGGGTATCATAGCAGTGAACTTCAGTACAACGAGCTCTTTCTAGTATATAGCGATTTCAATCGTG
ACCTGAGCAGGGCCCGTTTCTGAATCTGATACCGCACGATGTGACGTAGCACACTTCCACGCAttgagcagcacaagagCAAAGCATGAGCGGCACGACG
GTGGTGGGCACAAGGTTGCACTGGCAGAGCCACACGCAGAGCGAGCGGATCGATgtggagaagttgctgcgtcAATTGTGCGAGTTCTGCGCCCGTGCAG
CGACGTACGCGGATGGCGGCATCCTCATCGCCGTGGGGCTTccagctgcgactgctggCGCTATAGAGTCAATCTTACCCTCTTCTTCCAAGGCCACCAA
CGTACCGGTATTCGTTGATTCGGTGCGGGAGTTTATGACGAAGTTGCAGAACGAAGTGGCCACCGGTGCAATCGCTGGCAACGTGGAGATCATCCCGATG
CTGTACTGGGGGAAGTTCGTGCCGGCGTTAAATACTCTCGTGGGCACTGCAGCCGACCATTTTCCCGACGCAGaatcactgctgcttcaatctctggaga
tcgaggtggaCGCGGCTAGTGTCGCGTTGTTACAGTCTAACTTCGACCCAGAGCATGATCTTGTCGTGGGTGCGGCATTGCCCGGACACACCTTCCAACC
CGATCCAGCTATACAACCGCTAGAACTGAGCGGGTTGACGTCACCGTGGAACACGTTGGCACTCTGGAACTTACAACAACTGACCAAGATCGGCTTTGCG
CTCATGGGCGACGCGTTGCGTCTGGAAGTTGAGGGTGTCGGCCCTGCCGGCGGGGACGAAGAGGTCTCGACCATCTCCATGTACCAGCAACTCTTCGCCA
AGACATCAGCCCCCTCACGAGCGAAACTTATTCGGGTACCCGACGTCGTCTGGCAGGTGGGCGATTTCAAGGACCCCGAGCGCGTGGCCTGGCACACGAT
GAAAatgtgcagcaagaagcagcgcaccGCGGCGCAAATGGCGCACTTCGATGGCGTGGCCCCAGGCCGCGTGTACCACATAGAACCTTCACTTCAACGG
TAAGAGGTTGGTAAGCTTAGAGCAAGAACATAAAGAGGTTGATACTGTGGAGCAATGCATCGCTCTTAGAGCAGCCGACACTCGGAAGTTGAAGGCGAAC
TTGGGTTTGATGACTCCCATCCTTTGGCTCCTTTTGTTCACGCCGCGCAATCTGCGACACCGCGACGGACATTATCCCGCTATTTACGGTAGAGCGTCCT
CTTGAAGCCAAAGTTGCTACAGCGACAGACGACGTTACGGAGGCTGGCGGCGAATGATTTCGGGCGATGGCATCCAAGCGCGCGCAGCCTCTCTGCGCAA
GGAAGCGACTAGGCGGTGGCTCGtgaaggacgagctggtgttCCTACTGCTGCACTACAAGCTGGTGAGCGTGCCGGTGCTccactcgctgcagctgcga
ccGCCAAGTACGTCGCGTGGTCGCGTTCCTTAATTAAATGTACGGACTGAcccgctggtgctgctgttgttggtgaTACCTATGTTGACAGGCGGCACTT
TGCTGTTCTACAACACGCTAGAGGTCTCGGACTACAAGAAAGATGGCTGGCACTGgcagaagcgcaaggacaAGAGCGGACGGgtgcggcgacgacgctt
tTGGagctgatgatgatgaagttCTAACCAACGTCATGTGGACTGTGGCTGTTGTGTGGCGCAGGTTCGCGAGGACCGAGCGAAGCTTGTAATTAACCGA
GAGGTCATAATCCTGGGAACGTATGTGCATTCCGCAGACACTTCCGTAAGTTGGCTTGCTGGCATCGTAAATAATTGGGCGCTCTCGTTAATGGGTTGAt
ggttggttggttggttgCAGACATTCCATCGGAGGATTTATTCCGTGCGCGATGCCAAGGAGAATATCGTCTTCGTTCACTACTTTGACGAGGTGAACAA
GGAAGCTACGGGACGCCAAATGCCGTCAGATGTGAGCAAAGGGATAAAACGGTCGTTACCCGTTGCCAAAGCAACAATGTCGCCATCCTGGCAACCAAGT
CCTCCCAAGCCTTTGTCATCAGATGAAACAGTTGACTCCTTCATGAAAAGTATGTAGGTGGTCTATGCATTCTCCGGTCTTCCGATCTCCTGACTGTCAT
TCTGTGTGATTTTTTTGTCCAGACTGTTTCGAGATGGACTTTGAGCCTCAAGCGACATCGTATCAGACTTCTTCGTTTCCCATCTCGGATGCGGATCTGC
TGCTATTGAAGGACAATGGCATGGACGGGATTACCACAGAATTCGGTGCCGACGACCTATTTAATGACCTAGCTTCTGCAACCTCCACAGAAAATAGCAT
AAATGGCTTGGGAGGCCAACTGACTTTTGAACTGGCTGAAATTTCAGATTTCTCGCCAGATTGGGACTTCGGAGACGGTGGGGCCAAGATCTTAATCTGC
CTAGCGGCAAAACTTCCAGAGAGTCTGGCTCAAGATCCAATGAAACTGTTTGTGCAGTTCGGTGCCAAGCGAGTGCTTGCGGAAAAAGTCTCGGATACAG
TACTGCGTTGTACGGGTGCGTCTATATTACCTGCACGTTTCCTATCAAATGGCGTCTATGCTTTACAGATGCTTCGAAGTATGACTTAGTACTAACGGCT
CGTTTAACAAAAACTTTGCTGCACGTGTTTTTAATCAGCTCCTAATTCTCGAGATCTTGGCAGCGTCGATATTTACCTGTGCCATTGGAGTGGATCACTG
CAACAGGAGAGCATCCAGCTGTCCCACAAAAAGAAGTTCACGTATCGAAGTCACTACCAGGTGTCCCCTTCACTTGTGGGCGAAATTGCTAAGGATACAC
GCGTTCCTGAAGCAGGATCTATTGATCCGTTGGAACTTACAGCACCATATCCTGTGCATTGCACCTTCGGCACCGGCAAGCGAGGTCGATCACCGACTGT
TCTATCTCATGCAGTTGTTGACAGTAAACGGTCAGAAGACAGATTTTCTGGGTCAAACAGAAATCTGTCGACATACGTCGAGTCGGATTGTAAGCCATCG
ATCATTATTTGGTGTGTATCCTAGATGCTCACACTTTCCATTGTTTGGTATGATGTGTTTAGTGGACGAGCGGCAGTGCAAGATTCGAGTGGTGGAGCGG
CTGTCCGAATTTCACCAGGCGATACGCACAAAAGCAGCGGAGCCTGCAGCTAAAGGTATCATTTCTGTCACTTCTGGAAGTTGTAGCGGCGAGGGCGAAA
GGGATATGCcttcagaagaagaagacaaaccGTCTTTACCAGCTATGCTGCCATCTCCGGGTACATCAACTAACCAAGTGCAGCACGCTAGCCAGCAAAT
ATCTCAAGCGAGTGTGTCTGTGGAGCCTTCAGCCACGTTAATGTCTTCCAGTGAAACATCGACTTCGTTGGACGATTGTACAATCGAGGCACTGAGCGAC
AATGAGTTAGAGCAGCTCTCCGAAAAACTACTCGAGCGTGTCGTGCGTCAGCTTGTGACAGTCGCACACACAAgcgaagagctgctggaggagctcaacT
CACTGGATGAAGCTGGTTTGAGCTTGCTGCACTACGTGAGCTTCTACAACTATTCACAGTTGGTGCCTGTACTGGTTGCTCACGGTGCACATATCAATCA
GCAAAGTACACAAGGGCAAACAGCGCTTCACCTAGCAGCAGGGTGTGGACACAATGATGTGGTCGatgtactgctgcagtctgGAGCAGATTTGCAAGTG
CGTGACTTTGACGGACTTACTACTGCTGATCGTGCAGAAAAGTCTGGCCACACAGACGTTGCAGCGAAATTGCACCATCACATGGGGGATGACACCTCTA
GCGACTTGGGTGTTGTCGATGATATATATGGATTTGGTGGATCGCCGATGGAGATTGACGATGCCCCGACGCCTTACATGGACGCTGGAGACATGGGCCT
CTTGGAAGACAGTGGCCATGAGGTGACTAGCGTACGTCCACCATGTTCTCACTCTAACAGTTGTGAGAGTCCTTGTGAGGCAAGCTTATCGTCGAAAGCG
ATCTCTTACGTAAGTGCTTGTCATTCTTGGTGTTGTTACTGGATTGCATTGCTAATTGGAATTCATTGGCTTTGATTGTTATTCCGCAGATGGGAGAGAA
TCAAGAGCACAATCGaaagcttctgcttgggGCCTTTTCTACGATGAGCTTGCATGATAAATGCGCGCTCTCATTGAGTATCTCGAGAGACTCGGCGGGC
CACACAGCCCGGCGTCGTGAAAGCAGCGTTGGAGAAGATATTCTAATCTCTcccagtagcagcagtacgGGGACATCGGCGGGCTTTGGTTCATCTCCGG
CAAGCATGGTTGGCATGGATACCAACCTTATCGGTGGTCGACTAGTGCTGCCTGGAGCTGAAAATGATTCGGATGTCCAGAGTGTAATTGCCGAAGATGA
GGAAGGTTTAAACAAGCTTCAAGTAGCCATGGAACTCATGGGCCCAGAAGAAAGACAGtcgctggaagacgaggtgaaagtgctgcagcacggtATCCGA
GCGTGGTTGCTCAAGCGGAACTGCAAGAACATGCGTGAGACGACCAAGCAGCTTCGCGAAGCCACGCAGAGTattgagcagcaagaagccgcAGAACACC
TTTCTTTGATGGCAAGTGAGCAATCAGAACGTGAGCGTGCCGCCGTGACTGTCCAGGCCGCAACGCGGAGTATGCTAGCTCGACGCAGTTTCCTGCAGAC
CAAGCACGTTGCAATTAAGTTCCAAGCTGCCACACGCGGTGTGCTTTGCCGCAAAAATTTCGCCCGCATGAAGGCACATGCTCTAGCCTCACTGGTGATC
CAGCGCAATGTTCGCGAGTGGTGGAACAAGCAGCCAGCTGCAACACGACCAGGAAGCATCGATAATGaagcggacgacgacgaagaagaaaaagacacag
aagaagagaaagcACTGATCCCGCCAGACGCGtatgaactacatgtagcgttGCGTGACGAAGTGCACCACAGCCTGTAAATCGTAAATCCCGCCACCGA
AGTCATAACAGTGTAGCATAGTCCAACATCCAACATCCAACATCCAACCACcttcttgcagcactgcacGCTCCATCTCTCGTTCTATTTGCCGCTCCCT
CTCCATATCGACGGCTGTAacgtgctgttgctggaacCACCTAAAAACTGCCTTAATCCATGGCCTCAGCTCCTTCGTCCGTGAATCGTCGGAAGCCCGG
GATGGGGGGAGTCCAGGTGGCCATGCCGCGCTCCTCCGGGGCAGGAGCGTCGTCGATTTCCAGTGCCTCAGCCTGCAGCTCAGCGGGTAGCGCGTTGATG
GCCTCCCACTTGAGGTCGATCTTGGTCTGCACATCGCGCATGAGGTGGTTGTGCTCGATGGTGCTCATGACGTTGAAGCGGCGGCCGATCtcctggtggc
gctgctgctcctcctctgtcCACTCCTCCCTGCAGCACAACATTCAAGCAAAAATTAGCGTGTTGTTATGGTATTGTAGCGCAAAATACAAGTGCAACAG
CGACGTACGCGTCCGGGTACTGGCCCTTGATGGcgcgcagcatctgctcgaagttggcgtcgtcgccgcccttcttgcccttcttcttcttgtccttgga
CGCGAAGCCGCGTACGCCCGCAGAGGACGCGGCGACGTCCGCCAGTGCGCAGACGGCCGCCCGCTTGGCGGCCACGGAAGTCACgctacgcagcagcaga
gtcATGTCACTTGGTACTCTCTAAAGTAGCTTGAGCTCTGGACCACAAGCGCCGCCGCTAGATGCGCTAAGTACGAAGTGGTGTGTACTACACACATTAG
TGTGAAATAAATACATTTATAAAAACAATAATTGTCCTGGATTAAATGTC