Description :
From Genome Similarity Track
Location :
Scaffold_7:491653- 493218
Sequence
1565 bases(100 bases per row)
CGGCCGAGAACCTTCGAGTCGCCTTTGCGCTCTCCAATCTTGGCGGACGTGCCAGGACTTGGGCGTATACGCGCGAAGCGATGTCGCCTGGATGTTTCAC
ATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCTTTTCTCCCGGCGAACAACGAGTTCCGCCAGCGCTCGCGCTTCCTTGCCTACAAACAAGGGGAG
CGCGAGCTGTACGCGTACGTACAGGAGATGCGCACGTTGGCAGCCTCGCTGGTGGGGAACCCACTGTCGGAAGACGTCAAGATTATAGTCTTCGTGGACG
GCCTGATGCGCGCACGCAGTTGTTCCGCGTGCGCACCACCACTATGGAGGAGGCGATCCAAGTCGCCCTCCAGGAGGAGTACAGCCGCAAGCAGGCTGGT
GCTCTGGCTGTTGTACAGCCTGTGGTCGCTGACAGCGAACCAGAACCCATGGATCTGAGTTCGGCTGAGCAGTACTCAGCCCGCTGCTACGGCTGCGGCG
GACTAGGACACTATCAACGTGTCTGCCCATCGCCTGGGTCTGGGAAGAAGACCTACACGAAGACCAGAGGGTCAAGGGGGCGCCGACGCCATGCACCGTC
AGGTGCTCAAGGGAGACACAACCACCAGTAAGGACGAGAGCCTTGCTGGGGTTGACCCGAGTCTTTGTGATGGGTGTACGGAAGGCGTACACCACAGAGA
CCCGGGGTCCCTTGCGAGCACTGACGCTCGCATTGGTGAAGGACAACGGTGGGTTGTCGGTAGTACACGTGAGGGTACGGGGGTAATGATATCCCTAGAC
ATGATTGAGTCTGGGACGTCGCGTGGATGTTCGCACACCGCCAGACATGTCGGTTGGAATAACGACACAAGTGTCGAGACTCTGCGAGAGAGTCGAAGCA
CAAGGGCAGGTCTCATTGACTGAGGCCGGGCCGAAGAAGAACCTTGAGGTCCGCTGTGACCCTGGCTGCCGCGTGTGAGGACGCGGGCAGCAATGGAACT
GCACATGGCCCCGGACATGCAACCGTACATGGTCCCGGACATGGTGCCGAAGATGGCCCTGGGCATGGAGCCGGATATGCCCTCGGTTTGGACAAGTATT
ACTTGGTCCTGGGTGCGCCGTGTAAGCAGCACGGGCCCTCGATCGAGTGGCGCGGCAACGTTTTTGAGGCGAAGCCGGTCCTCTGTTTCTGCCAGAGCAT
TGGTGAGTCATGTTCCCACCTCTGGCCAGACACAAGGGCGTCCGATTGGACCGCCAGGGCGCTGGAAGCGTCCCACAAGAACAAGCGAGTCATTACTGAC
ATGATGATCTCCATGAAGACGGTGCAGTGTATCTGCAACCGAGGGCTGTTATGCCTAGCATATGGAGCTGCCTCAACAAGCAACTCCAGTGCTGAGAGTC
ATTGCTCGGTATGAGCATTGACAAGGGTGGTGTTCGATGACATCACCAGGTGGGTAACCAAGGACTACTGACTAGCGGGTAACTTAGTTCCGCACAAAGC
ATGTAATGCTGAGGAGGCCGCTCAAGGCACCTCCGGCGTGGGTAACCAAGTACCACACATGGTCG