Description :
From Genome Similarity Track
Location :
Scaffold_184:49156- 53190
Transcript NameFunction/comments
Phyin_T30-4PITG_20402Putative uncharacterized protein

Sequence
4034 bases(100 bases per row)
AGGAATAGTGCAACCTGATTGACAGATCATTTGATATCCTGAAGTGTGATCGGTCGCCAACTACAATTGCTACGGAAGGACAATCGTGACATGTGGCGTG
TACATTGTATACAGGTGTGTCCGTCTCACCCAAGCGTGTCCGTCCCACATAAGTATGTCCGTCCGAGTATACAATCTGTATACGCGGACTTAGCGACGAT
GGAAGGAGGGCACTAGGGACTAGGGATGGTTTTGGATTAGCTTAATAGTGTCTAAAACACTTTGGGAAAACGTCCAAAATATCGTCCAAAACTCAAATAA
CTCTCAAATATCAGATAGAATACAGTTTGTATTCCTCACAGGCGTGCATACTATCCTGCATTTTACCGTTAGCAGCTTCGACATTGACGACGTTGGCACC
TCGGCGATAAGAGCACAGCAGCGTCCGTTCAAGCGGAAGTGCATGAAGCTGAAGGTATTAGCACACTCACAGCGGCCTCATCTGGACGCGAGCATGCCGC
CTACTTAATTGATTAGGTGTGGGACCAGCGTGGAGAATAGCCAAACAATACTGACAGGTGCCAATGTCAGCGCAACCTGTAAGGTCGTCACGACCTTGAA
AAGCATCAAGGGAGAGAAAGAGAGTTGGATGAACGATTCGCCCGTCATTCTGCTCGGAGCTTCGCTGATTATAGAGAAGTACTCAACGTTCACGATGAGC
AATGAGTTACTCAGGAGTTGTCTCTTACTGGCTTTGACTCCACTGACTAAGTACACAGATAAGGTGTAGCCGAGCATCATGCTAGAATACCGATGGTGCC
GCGCTAAGATCTTAGCGAGCTCAAACCAGTGATTAGACGAGAGAATGGTATCAATTCCCAGAGTCATATTATTCCTACGCAGTGCTGTCATTTTCTAACG
GGTGGCGAATACCAAGAATATCAAGATAATTATCTTGATACTGCCCAACATTAGAGCTGTGAACACGACGGTGTGCGCAACGATGGCATAGATGACCACC
ATCATCGAGAAGGTGGTGGTGGCTTCAACACTGTCGATGCCACCGTTCTGGTAGCGGAGAGTATAAATCGGTCGAGTGGAAGAATCAGGTGGATCTGTCG
TGGTCGGTTGTGCAGGATATTGTCAAGTAGCGCGGCAATACGCTGGGGTACACGCGATTTTCTTGGGTACAGTTTACTAAACTCAGCACGAATGATCGCT
AAACAAGGCTAATTTGAGATTCCAGTCAGGCCCAGATGCGATGATGCGGACGACGGTGGGGCGTGGCAGCGCTGTTTATATGAATGTTGAGATATATATC
GGCAGAAGAATAGCAGAGATCTGCGGTCAATCAAGAAATTCAACTAAATGAAGTGCACCTGCCTTTTGTAGTTTCCGCCGCATGCAATGGTGGTCACCCG
CCCGCAATTTGCCATCACCAGGTATTTCGATAGAACAACGTTCAGTATCAAAATCTATACAACGATTCACAAATAAAACACTCCACACTTTGATGGGATA
TATCTATTTATTTAATTACACTATCGGGTCGCGATCGATGACGCGCAAGATCTACCTTATCTTTGCTAATGGTGCCGTGGTTGATGTAGATGTAGGCCAG
CCTTTCGACCTTATCAACCGAGAGTCTGTATCGTCTCTAGGAGTGTATATGTTCAAATACACTCCATGCTCGCTCGCTGGCCGCTGGCGACGTAGGAATT
GCGAAGACATCTTCTGCTATTTTCTTTAGCAACAAAAATTCTGTGTCACTCGTTGCGCTCCAGTAGTCCCGCGGTCTTGACATCGAATACGGCTCTCGCA
GCATGTCTCCACCACGCCGCTTCACACTCTTGAACTTAAGAGCTTCGGCTGTTAGCTTTGGTACTCCGGTGGTGGGTGTGCGTAAGCCACACTGCTTCGC
CATTTTGCGGACTTGCTCATCTACGTTGACATCATCGCAACCTTCAAAGTCGTCGAGATCCATTGCTGGATCGAGCATGAAACCAATACCCATGACATTT
GTGTGGACATAGCTCCAACCTTTCTTGATCTTTTGGCGGAAGTAAATTCGGAGCCCCCTTAAAGGAAGAGTGGCTACATTCTTTTACTAGTGTCCAGCAG
ACAGTCTCTCCTCGTCTGGTGATGTAGTTTGGTATTCAGTTTCAGCAGAATATGTAGTGACTACACGCTCGGCAGCATCACTCAAAATTCCAATATCTTC
TTGAGAAACAGATTGATGTCTTACTCGTAAATTATTTGGATCATTCACTTCCGGTTGTTCTTCTTCTTTCTCCGGTGATGTGACGCCGTATGCTGAATGG
TAGCGAAGCCATCTGAGCCACTTAATCCCCCGAAACAAACACGCCATCTGCTTCGAGCTTTCGTAAAGCAGCAATAATGGGATCCAGTATTGCTCATTGT
CACGGTCTTCGGCTATAAGAAGGTCTCGCTATTCTGGACGACTGCCTGCGGCAATTTAGCGAGCGGCGTACGAAGAATGTCAGGCCCGATCAGTCCCGTT
CTCCGTCGCCAGATACCTCGTCCTTGGTCTAAAATGGAACGAAGAGGTTCAGACAGTGGAGCGCTGGTGCTCTTCACAATCTACGACTAGAAGTACTAGA
GCTGGTAGGAGGTACTTTGGTAAGTTGAAGAGCTGATGAGGGAGCTCTTAGTCGTGAATTTCCTTCTTTTACGAGAAGTGCTCAAGAAAAAGAAATAAGA
AACACGTACATTTTATTCATTGATTACGTCTAAGTTCTTACGTCGTCTTTTATAAGATACACGACCCCGACAAGAGAAGGAGATCGCGACATCATAGTCA
GGACTCAAAAATATTGTTTTGAGTATTTCCTGACTATTTCACACACTTCTCAAACATGCCTACACCAAATACCAGCGTGTAGGAACTGGTAGCACGAAGA
TTCGTGCACTTAGGCCCGTTTCGCGAATTTAATGTTGTAGCAGCTTCAAGTCGTCAAGAAGTGCTAGGTGGTCCTTTACAAATCGTGTTAGGGCAGCCAC
CCGCGACTGAATTGCTCGAATGACAGGTAACTTTTACATATCCAGCATCAGTAGATTAAGTACCCGAGCCGATCATCCCCCGGTTACGACACACGGCCGA
CTGGTATGAATGCGACCTGACGCACTTTTCATGTTTGGGGCATTTTCAGGGGAAAGTGACACCAGGTGAGTGGATACATGAAAGTTGTGACAGAAAGTGT
AAATGATCACAGACGAAGATGGTGAACACAGCTTTCGTACCGACTCACTTACTGTCGCAACTTGGCATTCAGCAAATCCCTTGTTGGTCGGTGGGAGCCA
ATCCCAATTGGGAGACGATACCGGTAATCACAGAGCCCCCAGTCTAGTTTATCCCGATACTGTTGTTTTCATCCATGCAGAGTAGGCTCCTTGACGTTAG
CGCTCGCGAAGCGTCTGCTGCAGTCCATTCTGGATAAGCTTTCCACTTTTTCAGCAGCTCTATCTTCTCTCTCTCGGCCCGCTGGGTGCACGTGCGCTTG
GACATCGCGCCCTTAATTCGGGATTGGCCATCGCAACCAGCCGTTCAAAACGAATCAGACTCAGATAATTCAGATTAACTCGCGCGACTTAATCTGAATC
GGGGAGAAAGTCAGAATATTTCGCGCGAGTTATTCTGACTCAGGGAGAAAGTCAGATTAACTCGCGCGAGTTATTCTGACTCAAGGAAAAAGTCAGGTTA
GCTCGCGCGAGTTATTCTGACTCAAGGAGAAAGTTAGGTTAACTCGCGCTAATTATTCTGACTCAGGGGGATATATTACAAACACAGCCACGTCGTGTAA
TAGGCCTGCAGATCGCTCACTGAAAATCCATCCATTTGCTGCTTAAGTACGAGCTGGGCTAGGTGATCCGGACCTGTAGCGGTGTATTCTTGTGGCTCAC
CAGACACTGGTATTGCATGAAGCCATGTTATGCTGCAGAGGTCGCAGTACTGAGTATAGACGCGCACGTAAAACTCGTACTGTACAGACCTCCCATGAGA
TAAGGCGTAGTCTTGAACAGCATGAAGAGCATGT