Description :
From Genome Similarity Track
Location :
Scaffold_18:491510- 498579
Transcript NameFunction/comments
Physo_131985hypothetical protein
Physo_131986putative polyprotein

Sequence
7069 bases(100 bases per row)
GACCGCCGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAGTACCATGAGCGCCAGCAGGCAAAGCGCGATGCGCTCGCTGCAAAGGCCGCGTCGGGGACA
ACCCAGTCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTACGAAGACGACGACGTGGAGATGGAAGAGGGCGAGGCCTCTTCTA
GCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGAGTCGAGACGCCCTCGTGAAGGAGACGAGTCGGACGCTTCGAGCTCGAAGCG
TTCGCGCGGCGAGAACGAAACTCCGCTCTCTGCTGCTGGGGCTTTAAGCTCCCCACGTGATGTGGGGACTTCGAGCTCTCCGCGCGCTGCTCAGGCAGCG
CGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCACGTGGGCAACACTGTGCCTCCAAACGAAATTCCGCTGTACGTATGCAGCGGTATCTACG
ACGATGCTGTTGCGGAGGAGCAGCACTTTGACCCGTTAACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCCACGAGCTCCGGCACTTCTCCAGCAA
GAAGACTTCTTCTCGCAGCAGAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAACGCTTTTGTTAAGAACTTCAACAAGAAGTCGGCTGCTTACCAC
GAGCGGGTTAAGCATGCCCGTGAACGCTTCGAGATATTCTCGACGCGCGGGAGGTTGGAGCAGCTCCACAGATCTTCTGTGGACGCTGGTATTCCATGCG
CTGTGCCCGAAGGCCAACAGTGCACGTTGTGTCTTCCGGGTGCGGCGCACTTGAGCGACCGCGACCTAAACGGGTACACGACGATTCGTGTACCTGAGAG
TCTCAAGGATCTCCGTGCCAAGTTCTTGGTACGTGAGGAACGCGACGATCGTGGGGCTTCAGGCGCTGTAGGTGACCACAGTGCTCGCACTACCTTCGCG
TCGGCAGTGCGTGGTGAGCTTCGTACTCCCTCACCATTTCCGGAACGTCCTGCAGCAGGACGCCCCGTGGCTCCCATGTATCTTGGTGGGGCGGAAACCC
TCTCCAACGAATACGATAACGAACCGGCTGCCGGTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAACAATCCAGCGTGTTGAGCCGCGGGCGTCG
CGGATCGGAGGCGGCGGTGGTGGGAACACGCCCCGGGTATGGTCAACCTGGGGTTGACCTTGGCCTGACGCTTGAGGAGCGGGTCGCTGCTGTGGAACAG
CATCAGAGCCGGGAGTTCGCCGCTCTGAAGCAGGAGGTGGCGATCCTGAGGGCTCAAGTCGCTCAGGCCTCGCAGACCGCGTCGGATATCTCTGTCGACG
TGGAAGGTCGCGTCGCACGCTTGGCCCAGCGCGTTCACGCGCTGGAGCAGAGGTCGCTCCCGATGGGGCTTCCGCTTCGGTCCAGCCGAGCTAGGTGGCT
CGTGCTGCCGGTATGGCTTCAGCCGCCCGACGTAAAAGGTCGGATGGAGGCTCATGTTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGCCAA
CACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGACAGGTTTTGAGTTGCTAACAAAACCAATGAA
CCCTTCTTGAATTCATTAGTGTTGCCCCTACCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCGATAGCGTCTTGGACAAACCGATTGA
CGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGTC
TGTGCCCTGCACAGACGCGTGCTTCTTCTTCTTCTTGCGCGTAGTCGCGGGTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTGCTGTGTTGCACTC
GGAGATCTTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTCATGGCATTCGCGTAAAAGGGTGTATGCCCTGTCG
AGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGACAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCAC
GCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGT
GCAGTGAAGCGCGGGTCCCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGCTTCGCAGTCA
CTTCAGCGGGTACCGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACAC
GAAGTCCAAAGACATGGACTGCCAACACTCTCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCG
CAAGCACGGACGTGCTTGCGCACCCATTTGTACTAGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAG
TCGGTGCATCGTGATACTCGTACATGATCCTGAGTCGCAGGTCATGGTCGTTGGGCACGACAACGCGGACCGCGATGTCGTCGACTGCATTATAGAGTAA
TAACCCGTCGTGCACCCGATGACGGTGTGCACGAGCACGAAGATGCTTCGGCAACTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAG
AGCTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTCAGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGG
CATCAGTCGTGGCGTAGTCAGGTCGACGCGAGGGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAA
TGAGAGCTATCTCGCCATCCGTTGCGAGGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGATCCGTTTAGACCACGAACGGTTTGCTTCCGAGTAG
ATACACTCGGAACTTCGCGAGTGCGTAGTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGT
AGACGACACGATCACGGCCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGACGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTC
GGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCCGCTTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAC
GAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGAACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGAC
GGCATCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGA
AGATACAATTCTTCAGGTCCGCATAGAGCTTGTGCTTGCGCATAAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTC
CGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCCCACCGAGCGCAACAAGTGCGTCACGTACCTGTTGAAGGTCGCAGGG
GCGTTCTTCAGACCCTGCAGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACTGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCT
GATAGAACCCATCGCGCAGAGCAAGAGCACTGTAGATAATGCTCCTGCCATCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGA
ATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGTTTGCTTCGGAGGGT
TAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCTGCCTCCGTCTGCCCGGCAGA
CATTTCTTGTAGCGTCTCGGCCCCAGACCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTCGTTCTGCGGAGCCCGGCTCCGCTTGGTTCTTGA
CCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTCAGTACCGCCGGCGGGTTCACCCCGCGGGCGAGCGACTTCAAACCCGGCTTGGTCGCCCGGCG
CTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGGACGTTTGCAACCGTCCGCACCGCTTGCAGCGTCGGCTCCCGGAGCCGA
CACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGACCCCCATTACATAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAAGCCATCG
ACTCCCGGAGTCGACGGCGTTACGCCACCTTGGCTCTTATTATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGCCTCCACGCCTGAGGCGTGTGACT
CGCCTGCGTCATCCGTGCCCCTTGAAGTCGGAGACTCTTCCTGATTCGCTGAAATGCGGGTGTCGACCTCCGAGTTCAACACATTTCCTTCATTAGCTGT
CGGCGGCAACGCCGACGCTAGCTGCTCTTGCGCGCGTGCTCGCGCGCGCCCAGGGCGCTCCGGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCG
CGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGACAGTGCGCTTCTCCCAATCGATGA
CCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTTAAACTTATCGTCCAGATCCAGAACGATAAAGGTCTCGACAAACTCTTGATCTTCATA
CGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAG
TCAAGCCTTGATAGACTTCGCAGTCGAACAATGTTCTTCGACGCGCCAGAATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTTACCGAGTTCACATTCA
GGATGACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGGGTGAACCTCACTGGGGGCTGCAGTACTCAGTGTCGCGTGTTCAAGGTCGACACGCGG
AACTGCATTGCCTGTAGGGCGTCTCGCGTTTTTTCTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATGGCCACCCTGCTGGTGCACGGGGGCCGTGCAC
TCCCGAGTAAAGTGACCGACTCTACCGCAACGGTAGCATCGCACATTGTTTCCCTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTCGAAAGGTCCATGG
GTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTTCTCCTGCATTGCAAG
AGTAATTGCAGCTTCGAGAGTACTCGGGTACTCACGGAAGAGATAGGTTTTCGCAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCC
TCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCAAAGAACTCCG
CCCTCGACCGAAACTCGTTTTGGGGGGCTCAAACGCTTGTCTGAGCACCTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGACGT
CCATACGAGCACGTCCTCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAG
CCAACCGAGGAGAGGTTCACCCTCTCTTCCGACATTGTTACTCACACTGAGTTTTAGCGATTGCGCGCGTGGTGTCGTCCCGGACGACACCGCGGTAGTA
GCAGCAACATCGCGTTGCTCCTTCAGGATGAAACCCAGAGCAACACCATGTTGCTCTGCCGGCGTTAGCGTACGCAGCATCGTAGCTACAGCCGCCTCAC
CAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGATCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAGCTTTC
CATGGGCACCTCTGTATCCATGGGAAGGTTCTCAGCACCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTA
CCAGGTGTAGTGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAAGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACT
CGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATA
TTGTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAAGCCT
CAGTCTCTATGTACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCATTTGGTGTATCTACACCAAGGT