Description :
From Genome Similarity Track
Location :
Scaffold_808:4914- 7222
Transcript NameFunction/comments
Phypl_g11056secreted RxLR effector peptide protein, putative

Sequence
2308 bases(100 bases per row)
TGAATTCCCTCTTTGAACTAGCTAAGCTGCTGCCCAACAAGGTACCAGTAGTATCTGTAGTTGGCAAATCCTTCCCGCACCTCTCCTAAGTGCGATATtt
tgatgacgatgaagtgaGCATCATGTGACACCCCCTTCCGATTTTAgctgatctcgtcgacaTTTTCTTGCTTACATTTCTGCCTGTTTCTTGCTGATTA
TTTTTGGCCGATTTGAGATGTTCGACTCCCCTAATAGGGGAGTCGAACCTCGCCAAAATCTGTCTGCCGGTATATACGTTTAGAAATAAGCAAAAATGAG
TGTTTGAAATAAGCCGTGGTACTTCCTCGGAAAAAAAAGGCTGTGAACTAAGCATGCAAAACTGGACCTAAAGGTCCCTTAACGGCCAATCACAGGCCTT
AATTCAATATAAGCTGCTCATTTTAAGGTGTAGAAATATCAGCCACCTCTAGAGGTTGGTGATTTCTAAAATAATATCAGCAAGATTTTGCTCTGGAAAT
ACGCCGAGTTCACAAGAGGTTCGACTCCCCTATTTGATGGCGGATCAATTGGAATAGGAATAAAAAAATCCCAGCAGGTTCTGAACAATGGAACCCGTTC
CTATTCAGCACTGCTGGTACGAGATGTGTTTCCACATCTTACGAGTTGCTATGCGAAAAGAGTTGCCCAGGAAAGTATACTTTCAAACTCATAGAGTTCG
GGGCTTGACACGTGAACGTGGCTGCGTCTCTGTTGAGGGATCTCTTTTGGTTCTTGAACAAAATACCCAAGACATGCGGACAAGCGTGCTCCCCGTATCG
TTTCTTTTAGCCAAACGTTTTTGGCAGTTGGTGCAGTCTGGTTTCCCGGAACTGGGCCGTGCTTCACGCTACGGTGACTACTGTAGACCGTTCCGATAAA
CCACATCATTGCGGTTGATCCAAAGCGCACAGTGCTCATGATGTAAGGCCAGACTCGCTCCTACTCCTGTCTCCTGTCCATCACACCTGCATCATCTTGG
AAACGGTCGTGGAGAAGTTGGCGTCGATGCATGGAAAGCTCGGGGGCCTGCCTGTTGGGCCAGCAGTGTTGGCGCAATGGAGGAGTGTGACTGACGCTCT
GTGCGCATGCGGGCATAAGGTAACATAATACGTACTTAAGAGTATTCTACAGATGCATAACTAAGGTTATAATATTACATGTATCATATAGTGTTATTAT
CTTAGGTGTGCACCTGTAGAAAATTTCTACTAGAAATGCTTTGCGTGCGGTGGCGCAAACCTGAAGTACAATGTCAAATACCGTACATAAAAATAAAAAC
GCCTTGCAGCATCAAATGGGACTGCCATTGCATGTCGTCGCTTACTCGGAAAAACTGACCGCTTGAAGGCAAAAATGTTAGACATATTGTTCCAAAGCAA
CGAGCTCGcgcactacatgtattatagcAACGGAATCCTAGCTCTCTACATGTAACCTTACATGTACTCTACTCGGAGCGAAAACAACTTTCACCATCTT
CATTTGTGAGTCGAGAGTCTGCACTGCCCAGGCAGCTGTTTCAAATTCCAATCCTACGATTGCCTTCCAACGAGCGATTTCCTGTTCGAGGGATTCAATT
CATCCATTGGTGAGGCTCAGTCTCTCTCTGCCTTCGCAGCCCCCTTCGGTCGGTGGTGCTTGTACGTCCGTGAAGTACACCCATGCGTCTTCAcagcgtg
gtgctgctggctgctgcatcccTCCTGCTTGCCTCAACAACAGCAGAATCTCCTTTTAACATCGGGCTATCAACCTCTCTGCGCATCTccgaccagcacg
atgccCCCGCCAAGAGACTCCTGAGGACTCATGCGAACTCAAAGACCGACCAAGACAACGAAGAGAGGGGTGTTACCACTACCGGCGTGGAGTCACTCGC
AAACTCGTTGAAGTCCAAAGTCAACACCGAGCAACTAGAGACGTGGCTCAAGGACGAACACTCCACggacgacgtcttcaagctgTTAACGCTCGACAAC
GCAGCCGATGACTTGTTGGCTAACCCGCAACTGCAAGCCTGGGTCAACTACATGAAACTTTTCAACAAGGAGAACCCCAAGAAACAAACAACTCTGATCA
AGACGCTCACATCGCACTACGGGGACGAAGATCTGGCCAAGATCATCGAAACGGCAAAGCAGGCCTCCTCTACTGTCACCATCGCCAAGCGACTTCAGAC
AgagcagatccagcgttggctcgagcaggagaaaTCCCCAGACGACGTTTTCAAGTTGATGAAGCTGGACAAGGCGGGAGACCAGCTTTTCCAGCAGCCT
CAAGTGGT