Description :
From Genome Similarity Track
Location :
Scaffold_161:49131- 50383
Sequence
1252 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGACCATGC
GTCTTTGGCACGGCCGAAACAGTACCACTCCTCGTGCAGCGAATGGCGAATGGCTGTCATTATTTGCGGAGTACAACTTCTCCGTCGAGTATAGGCCAGG
ACGACTTAATGTCGTCGCTGACGCACGCTCGCGCCGGCCCTATTTCGATCCGGCTGCGCCACCCGACACTGGTACGACCACTGTCGTGGTACTGACTTCG
AGTGTCCCGTCGTCAACCTTTGGAGGATATACGAAAGGCGTATGATCCGGAGATGGTGCGATTGACTTATCATCATGCAACCATCCATGAAGAACCTCAA
ACAGTTGTCGTTAGTGTATCGATCCTCTACGGATGGATGTACAGTTCGCAACGGCCAACTCCAATGTTCGGCTGTTACCGGCGACACGCCTCGTGTCGTC
GTACCAGATCACGGTGATCTGTGATTGCGTATCATGTATATGTACCACGACGCACTTGTTGGTGGACATCGTGGTCGTGAGAAAACATATCTCACAGTGA
GCCGCGACTTCTACTGGATCCGCCAGTATCAGTTCGTGTGCAAGTACATTCG