Description :
From Genome Similarity Track
Location :
Scaffold_18:491110- 492316
Transcript NameFunction/comments
Physo_131985hypothetical protein

Sequence
1206 bases(100 bases per row)
CGCATGAAGCCCAGTTGTAGTGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGT
TAATTATACTCGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCT
AAATGTAATATTGTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCGA
GTCACGGCACGTCAATCACGAAATTGACCATTCATCAATTTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCTCAGAAGAA
GACCGCCGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAGTACCATGAGCGCCAGCAGGCAAAGCGCGATGCGCTCGCTGCAAAGGCCGCGTCGGGGACA
ACCCAGTCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTACGAAGACGACGACGTGGAGATGGAAGAGGGCGAGGCCTCTTCTA
GCAAGCGCAAGGAGTCTATCGACAGCGATAGTCTCGACCCGCATGCCGAGTCGAGACGCCCTCGTGAAGGAGACGAGTCGGACGCTTCGAGCTCGAAGCG
TTCGCGCGGCGAGAACGAAACTCCGCTCTCTGCTGCTGGGGCTTTAAGCTCCCCACGTGATGTGGGGACTTCGAGCTCTCCGCGCGCTGCTCAGGCAGCG
CGCGATCCGTGGATGCCGTCTGCGTCAGAGATCGCAGACCACGTGGGCAACACTGTGCCTCCAAACGAAATTCCGCTGTACGTATGCAGCGGTATCTACG
ACGATGCTGTTGCGGAGGAGCAGCACTTTGACCCGTTAACGAATCAAAGGCGCGACTACTACATCGGGCTCTTCCACGAGCTCCGGCACTTCTCCAGCAA
GAAGACTTCTTCTCGCAGCAGAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAACGCTTTTGTTAAGAACTTCAACAAGAAGTCGGCTGCTTACCAC
GAGCGGGTTAAGCATGCCCGTGAACGCTTCGAGATATTCTCGACGCGCGGGAGGTTGGAGCAGCTCCACAGATCTTCTGTGGACGCTGGTATTCCATGCG
CTGTGC