Description :
From Genome Similarity Track
Location :
Scaffold_124:4911- 7396
Transcript NameFunction/comments
g17021.t1hypothetical protein

Sequence
2485 bases(100 bases per row)
CAGGTGTTTCCACCTCTTGTTGCTTCATCGGAGCGTCGACGTCAAACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATG
TGCCACTCCACACGCATCGTTAGGGCTGGGCCTAGGATGCCTCGGCTCGTGGCCGACCGCGCCATCGTTGGCACGCAGCGATTCTCCGCCATCGCGGCGC
TCACCGCTCAGCGGATAACGTGCCGCTCCACGCGCATCATCAGGGCTATGCTCACGATGCCTCGGCTTTCTGCCGACCATGCCATCAGCGGCCTGCAGCG
ATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTGCCGCTCCACGTACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAATCAA
CTCCGACACGCCGATGTCTAGCACGTTGACCGTCTCGGTCCAGTGCTCGCGCCAATAGCGCTTTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAA
GCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACCTCCAATCAATACATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGTATGAGATCAT
ATCTCGAATCCAGGTCAAGGACCAGTCAGCGTTCAACGCTATCGAAGTCCAGAAACTTCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACACGGGT
TCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCTACCAGCGCCTCGGCATACTGCCGACTACCTTCCATCGTGGAGCGTCAAGCATAATTG
CCCGACGCTCCCGAATCGATCAATATCGTTCACGGCTTATCAAAGCCCTTCACGGTCGCTTCAACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGT
TAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTCCTTGCTGAGGCTCAACAGAACTTAGTTCTTCCCCAGTAGGCCGCCCCGTGCCTACTAA
GCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAGCAGGGCTTCGGCTCGCCGGAGCCTGGCGCTGCTTACGCAGCGGGCAACCTGGTCGCA
GGTGCTGGGTGCTCCCACACACGAAGCACCGGCGGATGCCGATGCGCTGCTCGGCAGCAAGAAGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGATCCAT
CGGCTCGGGTCCACCCGAGGAGCCGGCGGCTCCGGATGAGTTCGTCTGCGACGTTCCCCACCCGGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCAAC
GCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGGAATACTTCCGTTCTGGCCACGCCAGTGCGAAGGCCTTCCATGAAGATGGTCACCGTGA
CCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGAGTTCGTAACTCTTGGACGAAGTCCACCAACTCCTTCTTTCCTTGGCGGGTAGCCAGGAA
GCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACACTCGCGACAGCTGAAGCTTCAGCTGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTG
CCACACGTTAGGGCCCACTCCCGGGCCCGGCCACCCAGCTTGGGCACGGCCAGCGCCACGCGCTGTTGCTCCGTCTGGAGTATGGCGGACGCCATGGCCA
TCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCTTGCCCTCAAAGGTCTTCACGCTCACCATGAGCGGCTTAGCTCGTGGAGCTCCATCCGA
TGCCGGCTTGGGCGTTGTAGACGCTGTCACAGCCGTCATCTTCTGTTGTAGATGTTCCAACAGAGCATTCTCATAACTCGAGAACGCCTCCAGACGCGCA
TTAATCGCGTCGGGGCCTTGCGAAGCAAGATAAGCCACACCTTCCGGGCCCAACAAGGACATCAGCTTTTTAAGCCCGTCCTGTTGGTTCGGGGGTAAGT
GGGCAAATTGCTCCATCCTCACGCAGGGAGAGTCGTAAGACTCAGGTGTAGGATTGATTACGAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTGCGT
CAGAGGAAGACGTAGACTCTCAGAGTCTTAGTTCGGTTGTAATCCTAGGTTCTATACCAGAACCAAGTACAGTCTGTAGATATGCGATCTACAGACTCCT
AGAGTTATTAATACCTTAAATAAGGCTAATAGACACTAGACTTCAAAACGTGAACTGATTTTTATTGTTGTTATTCGCGGCAAGGCCGCCAGTGGGGTAA
ATGTATAACACTCACTATCTACCATAGTGGAGCCTAGTAATATGCATGACGGGTGGCTGTGAGGCCACCAACCTAAGTCTCGTGTACACACACCAACTTG
GGTGTGCACACCATTTGTATGAAACACACTATTCGTGTACGATACACTAACGGGTACGTGTAACCCCGTTACAGATGACGTTATT