Description :
From Genome Similarity Track
Location :
Scaffold_163:4911- 5925
Sequence
1014 bases(100 bases per row)
ACAGACACAGAGATAAGTACGATTTAAAAGTTCGGCATCCAACCTTGCGCACACTCACTAATAGGTTCGCCCTTCGAGCTTGCAATAATCATATTTATGA
ATCGCCTGTTACGTACATCGTTGCATGAGCATTGCAGAATTACTACTTTTACATCACTGTCCTTGCTTCTCCCAATTTTCATTACCTCTAATCGTTGTAA
TATAGCCTTCTGGCAGTGTCAGCTCGTCAAGCGCATTACACTCTTCGTCAACAAAAACAAATAACTCTCCTGTGATCTGGTTAATGCTGTCCATGTTGCT
TTTAAGAAGGCAAATGCTAAACGGCTAGGTTCATTTTATAGCAATTACTAAACGGCTGGGTTCATTTTATTCGACTGGGTAATTCTGATTCGTTATCAGA
AGTAGCTCAGAACTACGCCCAATTTAGTCAGGAGTAGATCCCAAATACTCAATTCACTATTACTGTTTACTTACTTGCCCGTGCAACGCTCAAAATGAAG
GTGTCAGTACATTTTCGCTGCTAAAACCCTACTCCAGTCTATACTCTCTGGTTAGCGTTCTCTTACGAGAAAGATATCGCTTTTCGAGGCCATTTTGGAC
GCGATCGCTCAATTTAACACCACAACCTCACAGTCAACTACGTCCATTGAAACATGGTGCGTCTTCACAAAATTAAGGATCCCGTGTCGCATAGTATTAA
GGAAATTCTATTTATAGCTGACACTATGCTACCAAGTTGCTGTCCAGGCTGGCAATAAAAATTGTGTATATGACATTTTAAATGCAGAGTATACCCTAAT
ATGACGGACTACCAGGAAAAGGCTGCCATTCACATGGCGAACGAATCTCGCGACATGTTGCTGCCAAGGTTGTAAATCACGAGGCTTACGCAGCGCCAAA
GTCTGGATTATCCCCACACCGTTCACATCCACCACATTGTGTCACGCAACAAGGATGCAATCAGGGGTTGATTGCCGCTTTATTCAGCATCAAAATTATT
CGTCTTAACCTTTC