Description :
From Genome Similarity Track
Location :
Scaffold_2775:491- 3350
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2775-fgenesh-gene-0.0Cell surface protein

Sequence
2859 bases(100 bases per row)
AGGCAGAATGTTCCATTCGACACCAGTCCATCGAAAAAAATCTAGGGCGCTCGTTGATTTGGTTGTGTGTGGAGAAACTCCGCTGCTGTTTTTGCCGGAG
CTTAGATCACTTTTCTCCACTGTCTTTTGTCGCGTTTGCTGCTTCTCTCTCTCTCGCTCTCCATTTTTCTTGTCACGAGATTGCATTTGTTGTTCGCCTT
GCCTGGTGATAAATCGTGAGCCTTTGGTGCGCCGCTCCTTAACTCCATACAGGTTGGATGGCCTCTCCATTGTGCGAGGTGTTGTTCTCAAAGTGTACTT
CACTGGCATTACTCTCTGTAGTTTCAATATTTCCTTCATTCATTTGTCATTAGTTAGTCTACAGTTGGTAGTAGATTCTCACACACATACTAATTAGTAG
TCGCAAACGCAACTCACCACTTAAAAGTCGGCAATGTCGGGCAGATCAGGTAGATCTGGCAGCGCAGGCGAATTCGATCTCGGTGCGTGAGTGGACGCTG
GTGGCGGTGGACCGATCGAGGCGGACGGACCAACAGGCGCCTGAGCTGTCGGACTCGGGAGCTTGGGGCCGATGAACACAGGCTCGCCATCCGCAGCCGA
GCTGTATGGAGCTCCAGGAGCAGAGCTTGGCATCTCGGGATAGGCTCCTGGATATGGCTGACCCATCATGGGCACTCCAGGCATGTACCCGACTGGAGGC
TGGTAATACTGCGGCTGCATGGAGCCGTACGCCACATTGGTGTATTGCGGAGGATAGTACGGCTGAGGCAGATACTGCGGCTGGTACATCCCGTACGACG
GCGGTGAGGGGTACATCGGCATGCTCTGCGGCGGAGCTGGGTACCCAGGAATGTACTGAGGCATCATTGGATACGCGGGCCCGCTCTGTGGAGTTGCAGG
AACTGGTGCTGCCTGTGGTTGCTGCTGCTGGTCGAAAACTGGATGAGCAGGCTCCTGATAAACTGGACTCGGCGCTACCGGTTCGGGAGCAGAATACAGT
GGCTGTGTGGGCTCTGTGATCTTGATCACAGCAGGTGCTTCGGCAGTTGCAACTGGAGCAGAAACAGGGGCAGGAGTTGATACAGGCTGTGGATCTTGTG
GTGGTGCTGAAGCTTGCACTGGAGCTGGAATCGATACAGGAGAAACCACTGGGACTGGCGTCTTTACCAAGACGAGCGCGCTCGACATCTCAGCAGCATG
CGCCTCGGCCTCTCTCTCCTTCCGGTGAATTCTCTCGGCTGGCGTAGAATATTTCTCCTTGTCGCGACGCTTTTTCTTCCGCTCCTTCTTTTCATCCTCA
GCTTGTTGCTGCAATTGTGCGAGTCGAAGGCGCTCGACCTCCGCCTGCAGCTCGGCTTCTTTGGACTTGCGCTGTTTCTTCTCCTTCTCCAACTTGCCTC
GCTCGCGGCGCTCTCGACGCTCCTTCTTTTCCCGTTTCCGCGCTTTCTCGTCCTCTCGCTCGCGCATAGTATCGCGATGCTGGCGCGCAAGCTCGGCGGC
AACAGTAGCAGCGGCTTCCTCCTCTTCTCTTCGCTGGTTCTCCCGTCTCGCCCGTCGTTCCTCGCGCCTCCTTTGCTTTTCAACTCGCTGTTCTTCCTCG
TAGCGCTCTTCCTCTCGTTCGCTGTCATTCACAACTGAATCTGGGGACTCGAACAGCAGCAGCTCTTCTATCGGCGCGGTCTCGATCGACGTTTCGTCGT
GACTCGGTTTCTTGGGTTTTGACTTTCGTTGGCGAACTTGCACGACCTCTTCCTCACCATCGCTTCGATCGCTTTGGTGATCGTCGTAAACTGGTTCTTG
ATCCACTGAAGGCGACTCTTGGTCGCTCATCATCGAGCGTCGGGACTCGAGCGCTTGCTTGTCCTTCTTCTTGTTCTTCCTTCTGCTCTCTCGCAGGATT
TCTGGATCGACTTCGATTTCTCTGTCCACTTCTTGGTCTTCAAGCCCGGCCAGCACTTCATCACCAGCCGCCGCACGCGATTTGGTCGAATGAGGCTCTT
TTTCGACACCATAGCGAGAACTCCCTCCGAAATCATCAAACAAGCCCGCCTCCGACGATGCGTGCTCTTCATATCCGCCATCAGTCATGTGCGAGTACCC
GCCCTCGCTCTCGTTGTACTCGGACACGCTCCCAACGTACTGCGACGGTCGGAACGAGAACTCGCGCGGCGATTTCTTTGTCGGGTGGCGCGCGTCCTTC
CGCATGCTGTTGAGGCGCGCGGCTGCCATCTCTGCGTACAAATCCCGGTTCGACTCGAGCTTCTGCACGCGTTTCTTGAGCTGCTTCTCGCTCTTCTCGC
GCTCCAGTCGCGCTGCGAGCCCCTCGTCCACGAAATCCGCCAGGTCGTCGTCGCTGTCACCGCCGGATTTCTTTACTACTACTGCGCCAAAGCGGCTCGG
GCCGGCGTCTTCGAAGAGGAATGCGTCGCTCGCGAGAGCCGCCTTGTCCACGGGCTCATTGAGCAGCTCGTCGTCGAGAAGCAGAACTGGACGGTCCACA
ATGTCATACTTGGAGACCGTGGGGCCGTCAAAGCTCTCGCCAAAGATGCCCCAGTCGGCAGGCTCGGCTTTGTTCGCACCGCCAAGATCCGAGTCACTGA
GCACACTGTCCGCCCCCGAGCTCGAGCGGAAGAGACCGTCATCTGGCGACTGCTCCGAGTCGGTCACCGAGTGCAGACCATTCTCGCGGTCGACTTCGTC
GTCACTGTCGGCATCAAACACGTAGCTTCTGCTGGACTCGTTCTTGCGCATTGTACGCGAGCTCTGACGCTTGACGACGCTCGGTCGCACGCCATTGCTC
GCTCCACGCTGCAGTTGTCCCTCTCGTTCTTCATCCTCACTGTCGCTGGTGCCATCACT