Description :
From Genome Similarity Track
Location :
Scaffold_70:49087- 50610
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_70-fgenesh-gene-0.20Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_70-fgenesh-gene-0.9Mitochondrial Protein Translocase (MPT) Family

Sequence
1523 bases(100 bases per row)
CCGAGGATCAAGAGCAGGATCAAAATCACCAGCAGCACCAGAATAATCACATAGAGATTGGTGTTGTTGCTCTGTTTCGCGACCTGGCTCGCACACAATC
AATGCGTCAGAAGGACAACCACTTTCTCAACGACCTAGAAGCATAGACATACCTGCGCGGCACGAGTGCCCTCGGATGTCAGCCCATCCGTCGCCCGCGA
AACGTCGTCGTCGATCTCGTTCAGCAGGCGCACGTGCAGCTCCGTCTCGTCCTTCATCGTCAAGCTGTAGGTCTTCAAGTTGCTCACGCCCTTGCCGATC
AGATCCAGCTGCTGATCCTGGTCTGTACCAGCGCCGATCAGCATCAAGCGACACACAACCATCGCTATATCCGTCCGATACCTTTCATGATCTGGTTCTG
CATGCTGAGCAGCTTTTTGGAGTGTTCGCCCGTGATTTGGCTGAAGAAATATTGCACATGTCAATCGGAGTCGGACATTCTCGACCTCAGCAAAGCTGAC
AGTAGACCAACCCATTGGTCGATGAGGTCCGTCTATTGTATGCGTCCAGGTCCGTTTGCTAACATCACGACGCAGTGCAGTTATCGTCAGCACTGCATTA
CCGCGACACCAAAGCGGACTCCACACACCTGATCTTGCACCAACTCGGTCAACAACCTTTCGCGCCGCTCCATCTCCTGCTTCGTCCTGCACATCCATAA
TCACGGTAGCGTTAGCACACAAATACCAAATCAAAACATGGTGTCCCGAGAATTTAATGCTCGCAACGCACACAGAGGAAGCGGACGAGCGCTTGAGCTG
GTCAAAGTCGCGCCGCAGCCGCGACACTCCCTGCTGCAGCGCGAACACGCTCGTGCCGATGGCGGCCACATTTCCCGAGCGGATCTTGTTTGCCAGCGCC
TTCTCCTGGCTGCGCGCTCCCTCCAGCCGGTCCAGCCAGCCAGCCCACGCCGTCGCGCTCATGGTCCCGCGCTTGACCCGACCGCTTCCTTCCTCGACCG
CCCGCTTCGATATCTTCTGTTTCGCTTTTTTCATCGGAAACACAGCCTATCCCGCACGTTCCGAACTCAGATTGATGTCGTCCCTTTTCATTTTCCAAGT
AAAAACGGGATTGTGTCCCAAACAACGACATTAAATGAGGGACGGATACCCGACCCACTCGTTTCGGAAGTCATCATCGAAAGCAAGAGCAAGGCGACAC
CAGCCGCACATCAAGCGACGGATCGAGGCAACGAGCGAACGAGCAGCATGAGCCAGCGGGAGTTTGAGCGCAAGATGGAGGAGCACATCGAGGAGATGCG
TGTGTCGCAGACCATCGCGTACTTCAGCCGCACGGTCGAGCTGTGCTTCAACGAGTGCGTGCACTCGTTCCGCAGCAAGAAGATGGACGACAAGGAAGTC
TCGTGCGTGAGCAACTGCGCCGAGAAGTTCCTGCGCCACACCATGCGCTCGTCCGTGCGTCTCCAGGAGAGCTACGCCGACATCATGCAGCAGCAGCAGG
ACCAGCAGCAGGCGCAGCAGTAA