Description :
From Genome Similarity Track
Location :
Scaffold_4:490824- 491960
Transcript NameFunction/comments
Aphas_H257_02944conserved unknown protein
Aphas_H257_02945Hypothetical protein

Sequence
1136 bases(100 bases per row)
AGGACCCGCAACTTGAGTCGAACCAGGTCCTCTGATAGTGCAACTCCATCAACCAGGATGCTCCCATCGAGGCTCAATCCATGACACGTACCTTCCAGCG
CATGCAGCAAGCATTCCTTCGCCTCCAGATCGTCGCGCACCATGTTGATCTCGGTCAACGTCACATGTCCTTTCTCCATAACGCCCAATACACTGGATGA
GTTCGTTCAAATTGAAAGCGCGAAAGGTTTACATACGGATAATATCCGGATTCCCCACGACATTTGGAAGTTTTGATACTCGCGTCCAGATGCAATTGAG
CTTGGGGTGAATCACAGCGCTCAAGATGAGGACCTGTGCTGGTCGATACGCCGACCAACCAGTGCACTGTATGCGTGCATATCTGGTGCAGGTGTCGTAG
GCGATGTCATTAGGCAAGAATTGATACTTTTTGCTATCTTATGTCACTTTGCCAGGAGTTGCATGCTTCCTTGAACACCCACCACACATGTCCAGGAAAG
GCTTCGGCGCCATTTTAGAACATCTCGTCTCTATTGAGGGCGACAACATGGCCATCCCTCACTCACGCCTTGGTCTTTGGACGCGCTTTCTTCTTGCGCA
GCTTTTCGTAGAACGACGCCAAGCCTCCCCCCCCGCCACCGTTGTTGCCGCCATGGTCGTTCTCCCCTCTTTCGTCGACCAAGTGTGGACTACTTCCATG
CGTTGTGACCATGTCTGGCAAGATCTTGGCCGATCGCATCTTCTCCAACATGGACGTCCGTTCCATGCATTCCCGATGGACGGTCTGCTGCAGCAGTTGA
ATCTCTTGATCCTTCTGGGCCACAATATGAGTCAGCCGCTCCACTTCTCCTTCCAGCGCCTTGTTATTGTTGTTGCTGGTCACCACTTCCTTGACCACTA
CCGTTGGCGCCGCGGACCGCATCTGCTGCAAGTCTTTCGCCATCGCGTCCAACTTTACATCGCGCTCGGCCACTTTCCTCTCCCACGCAACATGCTTGCG
GTCCCAGTCCGCTCGTTCTTGCTCCATTGCCGCCTTGGTATCGCGCTATTCCACCATATTAAAATATTATCTTATCACAATAGCAGCATTGTTGCCACTT
ACGAGGGCAGCTTCAACGTCGCGCAGCTTTTTCTCT