Description :
From Genome Similarity Track
Location :
Scaffold_133:4908- 9315
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_133-snap-gene-0.22Mitochondrial ribosomal protein L51/S25/CI-B8 family protein
Pytap_DAOMBR444maker-pag1_scaffold_133-snap-gene-0.23Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_133-fgenesh-gene-0.1Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_133-snap-gene-0.24Phosphatidylinositol kinase (PIK-L4)

Sequence
4407 bases(100 bases per row)
TGCCCAAGACGAATGGGATCTCCTGGTTCTTGACATCAATGACCTTGCGGTCGTTCGTGACTGAAACGTGCAAAGAATCAGCCGCTGAATACAATTTTGC
ATCGCATCCAACGTCCACATACTGTAGTCGCCAATGATGACTGGGTGGCGAGCGCCCTTGATCTCCGTCTGGAAGGTGACCTGCGGGTTCTCCTTCACAA
ACTTGAGGAAGCGCTGGTCCTTGAGCATGTCACTACGGCGgCACAAATTACTTCAGCAaCTAACAGTGCCTGTTGATGAAAGATATTTTACGGACCGCAC
ATGACGGCTGCTGCCGCCGTGCTGGCAGTAGCGGATCGTCACCTGCTGCAGCTGCCACACTCCGCGAGTCGCCATGATTCCAGtaGCCGCACTTGGTTGT
GGGAATTGTTCACCAGCCACCACACTCTTCCAGACCACAGCACAGCATGACTATACCTTTCCACTAAAGTACGAAAtGGTAATTCAGTAAGCGTGGGGCG
TACTTAACATGATATGAACTGTTCCGTAAGGATCATCACTCTGATCGCAATTGAAgTGACACTTACATTCATTGGATGTGGAGAATAGATATACATACAA
TAGCATACGATGGAGTCACCCAGTGTAGTAGCTGGTGTCCAATAGACGCAGCGCTGAAGTTGCATGATCCAGTACAGTAGTCGTGTAGTGGTGCATGCGG
CGGGTCTGTAAGTCACGAGTCACAGGTGTcGGTGGGAACGAGTCTGGtGAGACGATGCCGACGAAGCCAATACCGTCATTAATCTCCTCGTCATTGCCAT
CTCCAGAGGAAGGGTAGATGACAGCAACTCGGAACAGGTTGAGCGGCACAGTCGAGTGCATCATTTGACGCATCCGACGAGTCATCTCAGACGGCACCAG
CGACTCCTGCTCCATGTACTCGATCGCCCAGCCTGGCTCCCAACGCTCGTCATATTCTTCTTCCAACGCCAATTCGGCCTCATATTCTtcGACTTCTTTG
TCGATctCACATCCGCTTGACCGCCGGGCCGAAGAAGGCAAACATAAACTGGCACGTCGTCGCTGAAACCCGTGTTCGTCGTACTTGTCGTCTGGTGATG
TGAGAGGTGTTTGAGCATGCCATGTCTTTTCTTGAGGCTTTACACAGCTTGGGAGACCAAATAGTCGTTGTATACGAATCCAGATTTGGCGATATAAGCG
TGTCACAAGCGTTGATTCGTCCGTATTTGAGTGACTTGAAACTTGCACAGAGTAGTCATCAGCCTCTGCATGACTGTCTTCGTTTGAATTTGGTGGAAGG
AGCGGTGTAGAACTCTTGTTACTTGTCGACTCGTCAATCAGAGATAGCCAGAATGCCGTGAACTCTGCGTCTGACAGGGCGACAAACGAAGTCGCAAACT
TATCCAAAGAATCCGCCGCAAACATAGGCAACAGCTCATGCAgaTGGCCGTACCATTGCAAGATGGAACTGACGCAATAGCGTGCTTGGCCCCGGTCGAT
ATGATACAACACGAACGCAAGTGAACGAAGCAGTGACCGTTCTACAACAGTAACGACTGCACTCGAACCGGATGAAGGTGGCGAGGGCGctGTCGTCAAC
GTCGAAACTGACGAGCATGACGTCCCcGTGGGgCTTTtGCGCTTGAGACTTGGTGAATTtATCCGAGTAGCCCCcGCcGATATtGACCCAGCAACTGCTG
ACGTCGATGACGGCGTGGgCGCCCCAGATaCGTCATCTCCGCGGGATgTTTGTCCAGCGCCGCCGCTCATGTGACCCGTTGTGAGTTGTTTCAGTCGGCT
TGTGTTGACGCGAGACTTGCGCCCACGCACGTGCAGTGTGACAGCCAATCCGAGCGGCAGGGGCgCACACGTACAGCCACGGCGCGCGCGTCGATGGTGC
TCGCGTCCctCcaCCACGAAGATCGCGGAACTGCGAGTGGCTGTTTAtACGTTCGGTGACAACGTATATAGAAACgCGtCTTTAACcAAATCCATCTACA
GTGTCTGTGTTTGTTACAAGTGACACTTGAGAGaCAAACATTCTCGACCGCGATTTCGAGTCACGTCAGTGGTCCAAGCTGGCATCGGCATCGACTCTAG
AAGCCACCACCATCATCCTCTTgACGATGCTCTCCACCCGCGTGTTGCTCTCCACCACGGCCAAGCAGACGGCGGTCCGCGCACTGCGTGCAGTGCCGAC
CAAGAGCGGATCTTGCATGCTTCATGCGCCGCTCACGACTCGCCACGCGGGCAAGAATGCGGTGCGCGCCGCTCAGCTGCAGTTCCACGCCGCGTTCTCG
ACCAAGCGCGAGGACGAGGACCGTCAGACGCTGCCACCTTTGCAGACGGTGGAAGAACTGATTGCGGAGAATGAAGCACTGAAGAAGGAAGTCGCCGAGC
TTAAGGAGAAGATCGCCAAGGCCAAGCCGGGTCTCATGGCCACGATTAAGCAGTATGGTATGCCGTTCTTCATCTGGTGGACGGGTCTTTACTTCGCCAC
AGGTCTCGGCTTCTACGCTGCTTTCGACACGGGACTGCTCAATGGCGCGCAAGTGATTGACTTCGTCATGTCGCTCGGCCTCGACCGTCTCATCGACCCT
TCGCGCCTCGACCCTAAGCACGGTAACCTCGCCCTGGCGATCATCGTGAACGAGGCGATCGAGCCAATCCGCTTCCCTTTCGCGATTGCAACGATCCCGA
TGGTGAAGAAGGCTTtCGGCAAGAAGGAAGAGAGTGCGTAAGTACTGGATCGTTtCCCcTAGCTCTGAGAGTACGAGTAAGCGATATGCAGTAATGCAAC
TCATGTGATAGATCATTGTCTCTCTCACTCTCCATTCTAGCTTAGAGGAAcGGCATCCAACCGATGTACATCTGCGCGAGATTCTCGTGTGCGGTTGCCT
CgTGTATCAATTTATCGACTTGCCCTTGCACAGACAGCGGCAGCGTTTCATTCTCTGGTAGTAGACTTCGATGGGACGATGATACGAGAGGGCGGATCGC
ATCACCCAAATTGTAGATGCCACGAAGACGGTCGTCGATAGTCTTCAAAATAATTCGAGTTTCTTCTTTGCTCCGGTCGCTGGGGATATCGGCAATGCTC
CGCCCTGCTGTACTGCTTGCCATTCCCTGTGCGTTTTTGCCCCGACGACCCCACTCTACAAGTGGATCGTGGATGAAAGACTCCAGCACACTCCGTAGCG
TCTCTTtGTTGGCTCGTAGCAACTCCATCGTCACTTCACACACACGCCGAAAGACCCCTTCATATCCTGTAATCCCAAATGCGTCGATGATGTTCGGAGT
TAACCGGAACGGCACTATTTCTGGTTTGGCgaGCTTCAGTCCTTTGTCGAAAAGACAGTCAAAATCGACATGCACGCATTCACCGTTCGTGCAATCGATG
AGAATATTCTCACCGTGGCGGTCACCAAGCCCAATGATGTGACCGACCATCGACCACACAGCTGAGGATCGTGAGAACGTTAAACGAGCTTCAAACCATG
CCGTTGGATCGGAGAAGTTGTTTGTAAACCATTGGTGAAAACGCGGCGTGAACGTAGGAAGACTCAGAATTTTTCTTCTGAAGTACAAAGCGAGCATCAC
TGGGTCATTTGCATACTTCTTTTGCATTCCTAGAAAACGTTCTTTGATATCGTGGGTGAGTCGAACAGGCTGAATGAAACCGCGTTCAGTTTTGTGGATT
TGGCCGATAAGCTGTCGCATCGCTTTCGTGTGGCGCACCCATTCCATCAATCCGCTTTCTTCGTTCAAACAGACGACTGCATACGTGCGGAGGCGAAGTT
TACGTTTTCGACCTTCACGATCTTTCTGCAGCAGCTTGTTGATCATGGTATTGAACTCCATCATGCGCGCATCCTTTCGCAGGTCGCCAGTTTTCTCTCG
TTTGCACAGGAAGGGATAAAGCTGCCCGTCAGTGCCAAGAACTTCGATTCGCTTTGGCTTTTCCTTCGTCATCATCACATCTGCTTTGTCGCTGAAAGTC
TTGATGTGCACTTGAGAATGTGGCATGAAAGCTTCGTGTCGATTGTCATCAGGTGCAAGACCCGATGACGgAAGCACAGTATTGAGCGTCGCTTGAACTG
GAACAAGGATACGTGTTCGGATACGACTAAGTCGAATATGAATTTTCCGCTGATTCGCAGGATCATGCCCAGCTAGGCTGATAAGCTCTTCAGCAAGACG
CATCCCTTCAGCAAAGCTGTTGGCGATTtCTTGCTGTCCACTCGAAACAAATTGCCGCTGTGTCGCAGCGATAATGTCTCTCGCTCGGTTTCTGCGCTGC
GAGTTCagaGAtcGAGACAAGCCCAaCAGGGGCCACATGGCCTGAGTCGGATATGTAAGAAGCACTCTCATCATGATTTTTTTCACGCCATCTACGACAA
TCGGATT