Description :
From Genome Similarity Track
Location :
Scaffold_24:490759- 496048
Transcript NameFunction/comments
Phyra_77465ATP-binding Cassette (ABC) Superfamily

Sequence
5289 bases(100 bases per row)
TTGATGCGTATTGTATTTAGCATAGATTGGAACAGTTTTCTACAAAAATATGACATCTCTCTTCTAAGAGAGTGAAATTCTTTGAAATCTTCGGCTCTCA
ATACGACTAGCAGCAGCAGCACATAATTTCCCGCTGGAAGCTCCATCAACGATAAAATTGGCAGTGTCAAGCCACCGCTTTGAACGTCGGACAGCACCTG
GAAGATGATGGTACTGTGAAGCCCTGGCGCTCGCTGGTTGAGAGTGACCGATCTATCAGTCTAAATTTGCAGACAAGAAGTGGATCTGCATGCTGGAGCC
GGGTAATCTCGAAACATCGTTGTCGGAGCAGTATGAGACAATGAAAGTGCGTATCGAATCATTACAACATTTACCTTTTTGGTATTATGGTACGAGCTCA
ACTATCTCGCTTAGGACAGCGCTGTGATTGCTGGAGCTGGATAGCAAAACTCAAGTATGAGGCTCGAAAATCACTGTTGCTTAACTGTTATCCTCGAGCG
ATTCTTCTCTCTCGAGGAGAGTCCCCGTTGAGTCAGCGCGCTGACCCTCAATGATGAGCTGGTCTGCTGGTGGGATGATGAGGTTGTGTTCCTGCACTGA
ATTCAACATGTGCCGTCGATTGTTGCCGTCTGGAGAATAATCTTCGAGATTACGATTATGGTCGGAATTACCACGCCATACAAAAGGCAAGTGAACGGCC
GTTGTGAATGCTCAAGGTCACGAAAGTTTCTGGTGCACTGCGTTCATTTGGCAACTGACCGCCAAGGCAACAGGTGACTCGAGTTTCGAGGTTGTTGGCA
ACTTATCGGATTGCATCGGTCCCGATGGCGTCGGCCTCACCCAATGACGAGGAGCCTGGCAAACCCGAGATCGGGTACTCGAGTGGCACGGCATTGATGG
CCTGTGGTGCACTCGCACTACACGACCACGTCTCCTGTCGGATGGACGCAGCGTTCGGAGACGTACAACCCAAGGTTGAGTTGCGTTTCAAGGATCTGTC
GGTGTCTGCAGATATCATCGTGAAGGACGTGACGGAGAGTGCTGCAGATCTGCCGACGTTGCCAAACGAACTCGTGAAAGGCTTCCGCAAGCTTCGAGCC
AAGAAGCACTTGGTCCAGAAGCAGATTCTTAAAAATGTGAGTGGCGTGCTCAAGCCTGGCACTATCACACTTCTACTTGGACAGCCTGGATCAGGCAAGT
CTGCGTTGATGAAGGTGCTGAGTGGACGCTTCCCGGTCAAGAAGAACATTACGCTCGAGGGTGAGATGACCTACAATGGCGCGCCCAGTCAAGAGCTTCG
CAAACGGCTGCCTCAATTCGTATCGTACGTATCTCAATACGACAAACACGTTGCCACGTTGACGGTGAAGGAGACGCTGGAATTTGCGCACGCTTGCTGC
GGCCACGAGCTCTCGGAGAGCGAAGCTCAGAAGATCATGAGCGGCAGTCCCGCTGAGAACGCTGCTGCGATGGAAGTTGCAAAGAGCATGTTCACACACC
ACCCCGAGGTAGTAACCCAGCAGCTTGGACTCCAGCTGTGTCAGAACACGGTGGTTGGAGATGCCATGCTGCGCGGAGTGTCGGGTGGCGAGCGCAAACG
CGTCACGACTGGGGAAATGCAGTTCGGCAACCAGCAAGTGCTGATGATGGACGAGATCAGCACAGGCCTCGACAGTGCTGCGGCCTTCGACATCATTGCC
ACACAGCGCAGCGTCGCCAAGAAGTTCAACAAGACCGTGCTGATTTCGTTGCTCCAGCCTTCTCCAGAAATCTTTGGGCTGTTCGACAACGTAATTATTC
TAAATGCTGGGCGGGTAATGTACAATGGGCCTCGAGAACAAGCGTTAGGCTACTTTGAAAGCATGGGATTCAAGCGTCCTCCTCACCGAGATGTCGCGGA
CTTCCTCATGGATCTTGGTACGAACAAACAAGGCCAGTACGAGAACGAGCTTGCTTTAGGGACCGTCGTTCCTCGTACCCCGAGCGAATTTGCGGAAGCT
TTTGCTCGCTCCGACATGTTCAAGCGCATTTTTGCGGATTTGAATTCCCCTGTGCTACCAAAGTTGGTGGAGGCGAAGACGAAATTCATGGACCCTTGTC
CGGAGTTCTGCCATGGCTTTTTGGCCAGTACTGCCACGCTAATGAACCGTCAGATCAAGATGTCAATGCGAAACACGGCCTATTTGAAGGGACGAGGCTT
CATGGTGGTTGTCATGGGACTGCTAAACGGCAGTGTCTACTACCAGTTTGACGTCACCGATGCCCAGATTGTGTTGGGTATCATCTTCGCTTCCGTGATG
TTCTTATCGATGAGTCAATCGGCGCAGCTCCCAACGCTCATGGCGAGTCGTGACGTGTTTTACAAGCAACGAGGGGCTAATTTCTACCGAACGGCGTCCT
ATGTGTGGGCGAACTCGGTGAGCCAGGTGCCGCTGGCTGTCCTCGAGAGCTTCATTTACGGATCGCTGGTGTACTGGATGTGCGGGTTCGTACCGACTGC
TGGAGCTTTTCTGCTGTTTGAATTGACGGTGGTCCTCACGATTGTGGCATTTGCAGCATTCTTCCTCTTCCTGTCTTCTGCTACGCCTGATCTTCACGTA
GTGGAGCCGATTTCGATGGTGACCACTCTGTTCTTCATCCTATTCGGGGGATTCGTGATCACGAAAGAGAATATTCCGGACTACTTGGTCTGGCTGTACT
GGTTGAATCCCGTGGCGTGGTGTGTTCGTTCACTAGCTGTGAGCCAGTACAGTGACTCGCGCTTCGACACTTGCATTTACGGAGATGTGAATTACTGTGA
AACGTACGGTATGACCATGGGCAAGTACTCTCTGAGCCTCTTTGGAGTGCCGTCAGAGAAGTACTGGATTTGGTACGGTTTGGTCTTCATGGTGTGTGCG
TACGTGTTCTTCATGTCGCTTTCCGTGTTCTTCCTCGAGTACAGAAGATTTGATGGCCCCGAACACGTATTCCTTGACAGTGAGGAAAAGAGCGACAACT
CGGCAACTGACGGCTACGCCCTCGTTAAGACACCACGAGACCAGCAGAATGGACCTCCAATCGTGCTTGATGTAGCTCCTCCACGAGAAAAGAACTTTGT
TCCTGTCTCGATTGCCTTCAGGGACTTGTGGTACACCGTTCCTGACCCTGCTCGTCCGAAAGAGACCATCGATTTGCTGAAGGGGGTCACTGGGTTTGCC
TTGCCTGGCACAATTACAGCATTAATGGGGTCTTCGGGTGCTGGCAAAACCACGTTGATGGATGTCATTGCTGGCCGGAAGACGGAGGGTACGATCCAAG
GCCAGGTTTTGCTGAATGGACACCCTGCCACTGATCTCGCCATCCGCCGGTCGACGGGGTACTGCGAGCAGATGGATGTTCACTCGGTGGCCTCAACTTT
CCGAGAAGCGTTGACGTTCAGCGCTTTCCTTCGCCAGGGCGCCGACGTGCCTGACAGCAAGAAGTATGACTCGGTAAATGAATGTCTCGACCTGCTCGAC
ATGGTGCCTATCGCTGATCAAATAATCCGTGGCGCCTCAACAGAACAGATGAAGCGACTGACTATCGGTGTTGAGCTGGCAGCTCAGCCGAGTATTATTT
TCTTGGATGAGCCTACAAGCGGCTTGGATGCGAGGTCGGCCAAGTTGATCATGGACGGCGTTCGGAAAGTGGCAGACACCGGACGTACGATCGTGTGTAC
TATTCACCAGCCTTCCTCGGAAGTGTTCCAAGTGTTCGACAACTTGCTTTTGCTAAAACGCGGTGGCGAGAGCGTCTTTTTCGGAGACCTCGGAGAGAAG
GCAGCGAAGCTTATCAGCTACTTTGAAGCAGTCGACGGCGTCCAAAAGCTTCCAAAGAACTACAATCCTGCGACGTGGATGCTGGAAGTAATTGGCGCAG
GTGTAGGCAACACCAGCGGCGAGAAAACAGACTTTGTGCATTTATTCAAGGTGAGCGAGCAATCCCAAGATCTTCAAGCAAGCTTCGAGCGTGAGGGGTT
ATTCAAGCCGTCGCCTTCGTTGCCACCACTGGAATTTGGCGACAAGCGTGCGTCCACAAACTTGACGCAGATGAAGTTTTTGACCAAGCGCTTCTTCGAT
CAGTACTGGAGAACGGCTTCGTACAACTTGACGCGCTTTTGCATTTTTGTGGGGTTGGGTATCATGATTGGCATCACGTACACCGGAAGCAACTACAGTT
CCTATCAGGGAATCAATTCGGGTATGGGTATGATGTACATGACGATCACGTTCGTCGGCGTCATCTCGTTCCACAGTATATTACCGATCGCTGCTGAAGG
TCGTGCCTCTTTCTACCGCGAGCGTGCAGCGCAAACGTACAACGCGTTCTGGTATTTTATTGCGTCAAGTCTTGCTGAGATCCCGTACGCATTTGTGGCG
ACGTTGCTGTTCATGGTGGTCTACTATCCGTCAGTGGGCTTCACTGGTGCGGGCTCGTTCTTCCTCTACTGGTTCAACATGTCGCTGCACGTGCTGCTGC
AGGCATATATCGGCGAGTTCATGATGTATATTCTACCCAGCATAGAAGTTGCTGCGGTGCTGAGCATGCTATTGAACACCATTTTCTTCCTGTTCATGGG
ATACAACCCCCCAGCAAACTCGATCCCGTTGGGATACAAGTGGCTGTACCACATTACGCCCCAAACTTACACGTTTTCGTGTTTAGCATCGATTGTTTTT
GGAGATTGCCCAGGCAATGGAACTGGTTCAGAGGTTGGTTGCCAGGTGATGACCGGCACTCCCCCGTCCATATCGGACGATACAACGGTGAAGGCTTATC
TGGAGAATGATTTCCTGATCAAGCGCAGTGAGTTATGGATGAACTGTGGAATCATCATCGCCTTCATCGTCTTTTTCAGAATTCTGGCGCTGCTGTCTCT
ACGCTACGTTAACCACCAGAAAAAGTAAGCGGAGGAAATCGATCGGCTGATGGTATCAATACGGTACTTCGAAGTACGAGGTTCGTTGATTGCCAGCAAA
CGAGATTTGGATTATGAGGTTTAGCGATTACGATGCCCAGCGAAAAACACGACTGCACCAACTGGGTATCCCACAATCAGGGTACTGTTACGTGCTACAA
GGCCATCTTGCTTTGCTGCCAATGGCACAGCAACCAACGAAGCCGAACAAAGCCTTATCTGCTGGCGACGCCGAAACAAAATATCAGGCGGTTCAAAATC
GTAGAGAGTTCAAGCAGCGCCGAGCCGTGTTTGAGCACGGTGTGATTAGATACGTGTAGCTCACAGCCAATTTTCCTATTTTTCCAGCA