Description :
From Genome Similarity Track
Location :
Scaffold_205:49073- 51821
Transcript NameFunction/comments
Phyta_totarag5569conserved hypothetical protein

Sequence
2748 bases(100 bases per row)
GTGCAGCAGTACATCTGCGCACAGGTCGGCGGGCTTGACGAGGCCTCCAGTCAGCTGCTCGGCGTGCACGACAGTCGCTCGCGCAGCTACTACGAGGAGA
TCCAGGAGTTCCTCGAGCGCAAGCaccagctcgagcagcagcagcaggagcaggagacaGTGCAGCAGAGCACCGAGCGCGTGCTCATCCAGGGCCTCGA
CGAGTACCTGAACGAGCTGGACCCGAGCTTGTTCGTCGAGTCTGCGCCAGCCACCCCTAAGAGCCTCGTGGTCGCCAACCTGCCGGTGCACAGCAGCTAC
ATCCGCCGGAAACAGGAGGAGGCCATGATGGCCCGCTTGCGGACCAAGTATCAGGCCGCGGAGGCCGAGCGCTGCACGATGCCCTCGATCTCGTGCGGCG
GCCCCCTCAAGCGCCAGCGGGTCATGTGAAGGACAGCAGACCTCATAGAATATCTCTAGAGACAAGGGAGCACCTGGAGCGGGTGATTACGAACGCCAGC
GAGCCATCGAACCCCTCGGTACAATAGTAAACTAAGTAATTTATCGCCCATGAGGCGTTGTTTCTGCCGTAAACGTTTCTTCGTGCTCGACAAATAGGAT
CGCCAGCGGCCATCTGGAGCCTTGGCGTCAACAGAGTATCCAGCATAGAGTCAAGGATCCGAAGacgcagtacatgtacccgcAATGGAGATCGGATACG
TGCGGGTCTCTGCCAATGGCATCGAACATGCATGCAGCAAGGGTCGAGATTCACTTCAAGATCAATGGCAAGAAGTCGCGTGAGATACCCGCATCGTCTT
GGCCAAAGCTGTAGCGAGGAAGCTTCGAAACGAAGCTCATTGTGTCGGACGCGATTTGCTTGCGATGATGCTTCGCTGATTATGAGTGTTGAAGCTCACT
TGATGCCacgcggagctgcagcaacgcctgGATATTCTTGACTGGTCCGTGTGCCATTATTCAGGACGGTCATTTGTAGTACGGCTGCATTCTGAGCAAT
ATGCGTAGATGAACATGTACTTGCACTTGCGGGGCAATGCACCGGGTGCATCTGCCATGGTCTACCCTGCCTTGACTTTCAGAGACAGCGCTCAAGTTGA
GACCCCAACTGGTGTGTTTTACTTAACTACGGAAatactcgaagtttccgcgcatGGCttattgaatcgacaggatgaaaccgccgaacaaatcggCCAA
ATCGGCcaaatcacttcaattgactagGAACTATTcataagtacgaaatcggacttaagtgaaattccgAGAACATatggttttgctgctgtcgatcttc
gtaaatgacttgagaattgtataGTGGCCGTCTAGCCAACCAAttaacatcggcaaatttagacggaattgacaatattaataccggtaatcTTTATCCC
CCAGGTCGAAATCCTACTAGTAGCGAGGCGAAATCATACTAGTAGGCTCTCGCGCAGATAGATTTGTATTGGAATTTGTATTGAAGAGCATGTGGTTTTC
ATGAAAAATCAACTAGAAGTAGAGAAAGTTCAAATtgaagtcgacgtcgaagttAGTCGAGCTTGGTCAAGTGCTCGCTGAAGCAGTTCCTGCCTGAACG
AGGCCCACAAATGCCAAAGAACTTGTTGAATTCTGGATGCGAGCAATTGACGCAGTAGTACGACGATTTTTTCTCGCATACCCCACAAAATTTTGGTCTT
GCCGCTTACTCGAGAACCAACCAGAAGTTTACCCATGCTAGAACTCTCCGATGATGCTCAAAACTTACTATGTTGCCCAGTGATATTCCCTCTTGCCGAT
GATTTAAATGCGGCACGCAGGTGTTGTGGCTGTGACTGGCAAACTATTTTTTTCTTCGAGCCTACTAGTGGGCTAAATGGGGGATAAAGGACCCTTGTAA
GCCCCTAAACGAAATTTCGCTGGGAGGTTCTTTAAgccaacagccgagcaatcgaccaacttgtacAGACAATGATGGTGAAAGACGCCATAAGCAAGCT
TGCCGCTGCGGAACATGACTGACAAAGGCAACggtcgacgaaggcgacatggtcgtTGAAGGTGTTGTAGGCAAGGTGCGAGGAGTTGGAgaggtcgctt
gagcagttgttgataaaatgcaaagtgattgattaagATCCTTAGTTCGCAACCTGCTTGCTACCTCTAAGNCCGTGGCGTAAACACCGTCCCATAATCA
CCGTCCCGTCCTCATAGGAGTGATTGCAGTGTCACTGAGTGAAGATCAccataccggtgtctactggtatcccgcagctgctcgagacgccatcttgaca
acacgaggcactttgaaaccgAGGTAaaccttcaagttgaaggttgaccttGGGGCAGGCAAAGGCGGCGCGGCTAATTTTGGCCAATTTTTCTTaaatt
attaaaataattgGCCAAGCCGCCGGTTTGGTGGCTGTACGGCTAACAGCCTGgaagcggcaaatttagacgggattcacaaaCCTCTTTTCAGATCGGG
CCAAATAGCTATatatgtattattaatacttcgGAGTACAAAACAAATGGCCGACCACACATATCGTCCTCTGTAAAGCGAGTCACAACTTAAGTGTGAA
TTGCGCGACTTGAACAGTTCGCCCATTGAAATGAGATTACAGTATATCGGCAGCTACCGAGTGCAGCGTGTACCTCAGTATaaactgaagctgctcaatG
CAATCCAAAAAAACTCAACGCAGCTCGAAGAAAGATAAGCTTTTTCAA