Description :
From Genome Similarity Track
Location :
Scaffold_98:49073- 50077
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18986SF-assemblin

Sequence
1004 bases(100 bases per row)
GCAAGCGAGTTAAGGGAGGAAGATGTTTTAGCTACGACGCAGATCGGTATGACGGCGACGCGCAGCAAACTTGAAAAGCTCATGAGCAGCTTCACGACGT
TCGACGACGTCATGCGCATTGGAACGCGGGTACATTCTGTCGAAGGAAGCAAAGTTGTGAAGTATAGCTAACTGAGCATTTTGTGTCTACTTCCTTAGCA
ACGTCGCGAGAAAGATGAGTACCGCTTAGCGGAAATGCGGCAGGAAATGAATCGCCTAGAGAATAAACTCGAGGCGGAGATCAAGAAGCGGATTGAGATG
AACAAGTCGCTGCAGAATTACTGTGACGAGCAGGTGGTTCAAATGACTGCGTCCTTTGAGAAATTGCTAAGCGATCGCGCAAAACAAGTCGATGATCGAC
TCGACATTCTCACTCATGAAATAGAAAACCTTCAGGCACTTGTAGCCAAAGAAAAACACGATATCCCGCTTATGATCGAAAACAAGACCAATGAGCTGAC
GCAGAAGCTTATCGCGTTCATGGATTCGTTCGAGGATGAACGCCAGCGGCGCACAAACCAGGAAGCAATGATTCTGAAGCGCTTGAGTGATCACGAGCAT
GCAACTGCTGAAAGTTTCGAGCGTGAGCGGGTAAAGCAAGATTTAGCTGGTGTAAGAATTCGGTGCTAATTATCCTTTTCGATCATATCATAGCGTGATC
GTGAATTGAAGTATTCCGATCTGAAGAACGCGCTGGACACGTACAGCTCTACTCGGATACGCGGTGACGAAAAGTTCCACGCGTTCGCACAGGAAGAGAT
CGCAAAAATTCAAAATGCGCTGGTCGCTGAAGCACAGGCACGAAAAACTTGCGTAATTTCGTGACCTTATTCCGCGGTACTAACGCAGGTTTTTACTATT
GCCAGGCTCGAGAGCGCGAAGACGATGAAATCGTGGAAGCTCTCAATCGCTACACCGCCAAGCTGCAAGACAGTCTCAAGGTGATTACGAGTCCAGACGC
GTAA