Description :
From Genome Similarity Track
Location :
Scaffold_10:49069- 66570
Transcript NameFunction/comments
Physo_130058hypothetical protein
Physo_130059Adenine phosphoribosyltransferase 1 (APRT 1)
Physo_130060hypothetical protein
Physo_155989hypothetical protein
Physo_130061ankyrin repeat protein, putative
Physo_155991hypothetical protein

Sequence
17501 bases(100 bases per row)
TCCGCTTCCGCCACCACTTCTGGATGGTCGTGGCGTATGCGTTGTTCCACATCTGCGCTAAGATTTCCTGGCGTCGCTGGTCCTCCAGTCGGACCTTCAG
CTCGTAGAATCTGGCTCGTGCCTGCTTAGCCCGATACGCGTTCTGCAGCAGCACCGCCGCAGCGGTTCTCCGCTTTGATACAGTCTCCACGCGCGTCCCA
AAGCGCCGCATGAACTGAGTGTACCGAAAGAAATTGAACAGCACGTGGCTCGCTCGTGACAGTTTGTCGCGCTTCGCTTTGGCGCGGGCGATTCTTCTCC
TCGTTCGCCGCATCCAGATCTGAATGGAGATCGCGGCATGATATCGAGCCAAATGATGACACCAAGCGATGAAGTCGCGTTTCTTCTCGAGATAATGTTT
GAAAGCACGCGTTATCACACGTGCTGCACGTTGTTGCCTCCTCCAAACCGTACAGCGGACGCGGAAAAGGTACGAGTGGTAGTAGCGCTGGACCTGATGA
GCAGCCCGGTTGTATGCCAAGAAGCGTCTTCTCCGCTTGAACATTTTTCGTGAAAGAAACCCTCTCCAACGAGCTTGAATCAATGTTGCAGCTCGATGTA
GGTGATGAACAGCTGCAGCTTGCTTGCCTTTCACTCCGCGAAACCAACTTTGAATGTATACAGCAGCAGCGATGGCTTCGTACTCCCGTTGCTGTGCTAT
GGTAGCCATCCACTTGGCCCACAGACGAAAGACTAAAGATTGCAGTCTTGTGCGAGATCTTTGAAGAATCCATAGCGCGCATTTCCTTACCAGTCCAAGC
CGTGTACACAACGAATTAGTCACTACAATTCCCTGTAGGAAGTAGAAGATGTAGACGTACAGGCGGCAAAATCTGCGGGCCTGTTGGTGACATTGTATCC
ACATCGTTTGCTGGCGCCAATACATAAAGCGCCGGTGAATGACTTGGTGGAGGTGTCTGCGGACAAATATCTGGGTAAATAAAGCGTGAGTTTGGCGAAC
CAATAAAGACACAGGTATGGAGTCCATACCAATAACTTTTCGGCAGCAAAATGCTTCCTCATGGCAGTGGATCGAACAACTTCCTCCATACAGTGATCTC
GAACCCAATCTCGAATATCAAGTGGGCAACCATTTATCGACGGAGCTGTAGCAGCTATTGCATACACGGCAAAAATGACACTGTTAGCAGTGATCGATTA
ACTATTGTTGCCTGAATTCATACTGGTAGGCTTCGATGCTGTGTAGAGATTACCTGCTTTGCTGAGCATGCTACATTGATTTTCCAATTGAGGCCGGGGT
TGCACTGTTGGTCTCTCGTAACGTTTGCGTACGGGCTTCACTCGTACTGCGGGTAAACGCTTTGTTCTTATCACCTCGGGGAGCATGCTGCTGCAAGTCC
GCGAAATTGGCAACGTTCGACCGTGAACCCATAAATTCTGTGCAAGTCTATCACACAGCGAGACAGCAGACGCTTGAGAGTGATCAGGATGAGGATGGCA
CCACCCCCCTTGTTCACGAAGCATCGCTAGCGCCATTTCTAGCTCGATAACTTGATCATAGGACATCTGCGTTGCTCGCAGAAAGCTCGCGCTTTCTAAC
GTACAAGCAACATTCGGGCGTGCAAGAAGGAAGAGCACATCTTCCACTGCCAAGCATTTTCGGCGGAACTTGTCCTCCCAAAGAGTAAGGATATGCCCAC
GATAATTGTTGCCGATGGTGCCCAAGCTTGGTTGATTATCAGTATCGGCGGTGAGGACAGGTTGCTTGGAGAAAGGGTTGGCCAACGCGAAGGTATTGGA
GGCAGCTACTGGTATTGGTGCCACAGAACCACTGCGCTTAAATCTGGTGTCGTGAATACTCGCTACAATGCGCTTCTTGCTGTCGGGAGTGTTCCGCTCG
TATGATACGGGCTTCAGCAAGCATCTCGCCTCCCACAAATTCCTTTGCTCGGGTAGAACCTCGTTTAAGATGCCTGCTACACTCCATTCTGAGCCATTCA
GCGCAGCAAGCTGCTCGATCAGATTGTAACCTATCACAACCATCATCCGTCAGTATGAGGCCTGAAGCTCGGCGATATATTCTCACGTTAAGTACCCGCT
CGGTCAAACCTCCTACGACACCCACTCGCTTCAGTGTCTCCTTGTCGTTCTTGCATCTGGACCTTCACTGCAGTACTGACTTTGCTAATTTTGGTCACTC
GAAATCTACTCGCACATTTAGCTCCTTGGCCTCCAACAACTCGAGAAGTTCGTGGCATTCATCTTCGCTCAAATACGGACGCAGGACGCGCAAGCCATCC
ATGTACAGCGCTTTGCTCCAGGCGCAGGCTGCGATCCCACGGTATAACACCTTTTTCGCTGCCTCCACCTTTCCGAGCGCAATCTCAAAGCGCATATACA
GTCTCCAGCATAGCGCATTACCCTTTGTACGGATGTGGTTCACCATACTTTCAAACATTTGACGGATACGAGTGACTGTAGTGCTATTCATGCTCCACCG
ATGGAAGAGGCAGCACGTTGGCCGAGAGCAATTGTCATCGTCTGACTGCACAGGAAGGTACTTGACCGTCGCAGCTCGCTCAATGCGGCAAACTTCACAA
AGCAGCGCAAACAACCACTCCACCAGTTCCGGGGAATCATAATGTCGCCGCCAGCGCTTTTCTACCCGAAGGAAGTAGTTGCGAAGCACTTGGGAGATCG
TGTTACCCGTCTCAGCATCGACAAACAGCCGAAGAAATAACGCGTTGTTCGGAAACTTCTCAACTGCCTCACCAATGGAAGATCGCCACACTCGCGGAGC
AACAACTGGAAAGAAACCTGAAGCTTGATGCTGCTGCATGAACTCCAGGAAACAAGTCCAAACCCATCTTACGTGTGAGCAGTCTTGGTCTTTAGAGTTG
GCCAAAACTTGACGATACTCGTGGCAAGCCGCCTCAAAACCTTGATACGCATAAACCACCAGAGCCAAGTTATGTAAACAGTAGCCCACCGAGCAATCAG
GTCGACAGTGTGACCCGCCGAAAGACTGTCGACAAGAATCGGTGCAACGTAGAATCGAGTATCTAAGCTCGACACGATATCGAGCGATGAGATCCGTTTC
GGTCGATGGATCGGACGTCATAAGCTCCTGCAAGTAGCTGTGGAGCCGCTTTCGGTGTGTTTTCGCAATAGCATCAAGCGTTTCCCGCTCTTCCCCATTG
TGCTGGTCTGGCTGCCACACATTCCACAGTATATACAGGGATCTTAAAACTCGAAGTTGGCCTTGATCACGAGTTGGCTTTCCACTTAGTTTCTTTTTGT
CCTCCGCCAGAGGCCACAGTTCCGTTCGCGCGCGAAGAAACACAAAACGGTGAACATGATTTGTGTTGCTTGAGGATGGTGCACTTAGCGATGCAAGCGT
GTTATCGCAAATTCGCCGCACCTGACGCTCATTCCCTAATTTATGTTCGAGCTTGGCGTAAGCGAACAGAACGTCAAAGCCTGCGTCATGATCAACGCTC
TCCTGCGCCAATTTCTGGCTCAAACGACGAGCAAACGCCAACGAAGCTTCATCGACACCGGCTGCACGTGTAACCTCGGCTTCACAGCCAATCCACAAAC
ACTTCAAGGTCCTTACGAACTTCTCGTCAACGCTTTGGAAGGAACTCAATGCTTGGGCGAACACTCCGCGAATAAAATCCACCTTGCTTGGGTCGCGTAG
CATACTCTCCTTCACTTTAATGTCGTCAAGAAGCGCAGTCTGGAGGAGTGTTTTCCGGTCACATGGATCAAGAAACAACGCGTTCTTCGTGGAGTGATCT
GGTTGTGGGCTGAGAGCCGACAAAATGGGATTCACGAGCAGCTCACAATCCGCAGCATCGTCTGCGTACATCCACTGACAATCTTGAAGACCGTTCAATT
GATATTCACCACACCATTGGACACCGCATACATGAAGAAGCTGAACAACAAGTCGCCATCGGCACGACTCCGGTACAGTAAACAAAAACGGCTGGATTTC
ATCCGTCAATACGGCGCGATCAGGCTGCTGCTCAATAAGCTCCTGGTGAAGAGGATTGTTCGATTGCAAAGGAGCCCATTGCAACTGGGACTGGGCCTCT
TCACGCATAAGCCATTTCATGAAATGGTCGTCTTCGCTAATAGCAGCGAAATCTGCGCGTTGGTCCTCCAGTTGTGTTTTCGTAGCTGCAAGCACTTGAC
GCCTCGCTTTTTCCTTTTCAATTAACTGGTCTTGTCGGGCACGCGCGCTTTCCGTGCCTCTCAACTCGCGTAAAATGCGCTCGTATTCTTTCGCGTCATC
GGCATCATCAACGCTGATTCGATATCCATGCAGGTTGCTGTAAATAAGTCTACCACTTTGCCTTGAACCAGTCTCGGAGTCATCGCTTGGTACGGAATCA
GCCAAGTGTGTGATCGAATCATGTCCATTCTCACTTTCCACTGATTTTGAGTTTGTCTTTGACTTGCGCTGATAGTCAGCAGAAGCAGACAAAAGGTTCT
GCTTGTGTCCTTGACTTCGTATCGCTTCAGGGGGATTCACTTTGTCGAGTGAAGTAACGCAGCATGTTTGAATGTACTCCTCAAACCGAGCTCCAGATAG
TTCTGGAGGTTCTAGCTCAAATACCCGTCTCACTCCATTACTCGTATCCCATTGCTCGTTGCCGAATCCCACCGAAGTACCCTCGTTCCAACGTGACCCA
AAGTCTCGCAGCATTTCCAAGTGGTTCATATTATCGCCAGTCTTCTTCCTGGTGGCGTTCAGATTAAAATCAATTAACGCTTGAGTCTGAGCGATTGAGC
GTTCGACGTAGTCTGCCTTTTTCTCAAATATGCACATGAGCATGTGAAAGTCGAGAAGTAATGCCGCCAGATCCAGTGACTTTGCGACAGGTGAGCCTTC
GCCAGGCATTCCACCCCTTCCTGGAGCTCGGTTTGAAGGTTCCGTTGCTGTTTTCGCCTTTTTTTCAATCCCGGCTCTCAAAACAGTCAATATCCGCGCA
TACAGATCGCGCAAAGACTGCATCGAGAAGCTACCAAAGTGCTGCTGGCGACATTGAAGTAACTTGATCCATAGATCACTGTTGGTGAGATCTTCCGAAA
GCAGGCTTTCCAACTGCTGCTGAAACGAGTCCGACGCAGCACCTTCACCGGGCAATTGAGTTTGCAACGTCATGTTCAGCTTCACCCGATGCAACCTTCG
TGACTGAGGATTGCTGGCGAGGGCCTTTGACAAAATTGCAGCTTGTTTTTCCGCGACGCTCGCCTTCATAGCAGGATTAACCTTTTTTCCTCTGTTGTGA
AGGCGAAGTGTCTCCTCTTGAAAGGCTATCAAGTCGAGCCACTTGTCGATGTCACGTGGATCTGCTGCTACCCCAGCATTAAGCAGCTTACTTCGTTCAA
CGAGATGCTGCTCCACACTTTGGCCGTCAGTTAGCATAACCTCGCTAGTAGCATCACTGGTGCTTGTGGTACGGCCAGGATCCTCATCGACTTCATGAGC
CACGAGTTTATTGACGTCAACCACGGGGTCCAAAGGAATGAATGGCATCTCAGATAGACAGCTCGCAGCGACTTTTGCAGTATGGCCTGTTTGATCACCG
CCATCACCTTGGTGCGAAGCCGCCGCGCGAGATAGTCTTTTTTCGGAGTAGGCAAGATACAGCCGCTTCCGTCGGCCATCCCTCTCCATTTTGCGTGCCT
GGATGGAGAAATACCGGTCGGATTCTTGTTTGCCTTCTTGCTTGTCGGGCGTTTTGTTGAAATTAGGGCGTGTTGATGCTATCCAAGCACCCATGCGTAG
ATTCCGTCGCGTTGCCAGGTCATAGAGTGGCTGGTCGAGCACGTACGTTGATCCGAAGAAGCGATTCTCGCGGTCACCCACACAATCGAACTCGAAGAGT
TTTTCCTTGTCTTGCGCCTCGTGCAGCGCCAGGGTTTTATCCGATTGGGTGACGATGCGGTTCTCATCCCTGTAGCTGCGTGATGGAGACCGAGACCGAG
TACGAGACCGTGAGCGCGAGTTGCTGCGGCTGCGATGTCGACGCCGCCGTGAGTGATGCTTGGACTTGTGTGTATCGTCTTCATCGCAGCTATCCGACCG
ACTCCAGGACCTGCGGCGCTTCCTGTCCTTGCTTTTCTTCTTGTGTTTAGAGAGGTGGCGACCCTCGCGCTTCGTTACAGCACTAGACTCCTCGTTATGC
CGCTTCTCCGTCTTGTGCTTCTTCTTCTCTTTGTGACGATGTTTATCACGCTTGTAAACTTGTAATGCTGACTCAGATGCCTCCGTCTTCTTGTGCTTCG
CCTTGGATTTATCGTCGCCAGTGGCACTAGAGAAGCTCTTGCCAATGCTGAGCCAGTCTAGTAGAACGAAAATTAGGATCACAGTGTCGATTCGCCCCTG
TAGGAGGGATTGCCTAACAAGCACCTTGACAACGCACCATCGTCCGCTTGAGCAGCGTCGCTGCCTCCAGCTCCGACCTCGGAGGAGCCGGCCGCTTGAG
CAGCGTCGCTGCCTCCAGCTCCGACCTCGGAGGAGCCGGCCGCCGCCTTCCGACCTGCTGCGAACATGTTTGTGAATTGGTCCAATTGGATTGGCCAAAT
TATAGTCTCGACACATATTTTAGTCTCTCCTTGCACGCATTCAAGGGAAACATCAGCAAGTATGAGCGGTGAGAAGCTCGCAATGCAGCCGCCCGCGGAC
CTGTCGAACGAGGAGGAGGTGTCTGCGTACATTAAGCACAAGATCCGCGTGTTCAGCAACTTCCCCAAGCCCGGCGCAAACTTCAGCGATGTCACGTCGC
TGCTCCTGGACCCCGTCGCCTTCCAGACGGCGATCGATGCGCTCAAGCTCCGGTACGCGGACCAGCAGATCACGCACGTGGTGAGCTGCGAGTCCAGAGG
ATTTATCTTCGGAGCGCCGCTGGCGCTGGCTCTGCAGGCCGCGTTCGTGCCCGTGCGTCGCGCGCGCAGGCTGCCGGGCGACGTTGTGGGCGTGGACTAC
GTGTCGGGCTTCTACACGGGCCGCATGGAGATCCACCAGGACGCCATCTCGGAGGGAGGGCGCGTGGTGATCATTGACGACCTCGTTGCGTCGGTGCGTC
AGCTCGCGGAGAAAACACAAACTTGGTGCATTTTTCGCTAGTCGATGGCTTATGTTACTGTATTACTGTCTGCGGTGTTGCTTTTGCTGCCTGCAGGGCA
ACACTCTCAAGGTGACGGTCGAGCTCGTCGAAAAGCTCGGAGGCAAGGTGGTGGAGTGCGGCTGCGTGATCAACTCGTTGCGCTCGACGGTAGGTGCTGG
ACCACGAGGCATGTAATGTCATTCCGCCCCTAACTGACCACCGGATTTGCTGGTAATGTCATCCAGGAATCGCTGCAGAACATTCCTCTTTATGGCCTCA
CAGCAATGTGAGAACATGGACCTGAACGGCGCCAACAACGCCATTCAAAGGCGTCGAGGCTAGGCCGGCGAGAAATGAGTCGTAAATCACCTAGAGGTCC
TTCGGCCACAGTGTGAGTACCGTACAGAGAGAGTGTGACCGGCTCCACCTTGAGCGCGTTTTGCCTGTTTCAAAAAATCCCAGTTCGTTTTGAATCCTCC
AAACCTGTACGGTATTTATGCTGCTCAACTTCCACTACCAATAGTAAATGAATCACAAAGCGAACAGGTATAGTTGATATCCTGCCCTTTTCACGTAGCA
TTCGATATGAGAGGGGCGTCTGGCGCTTCCAAGATGCCAGAATCAAAAACCGAAAAAACCGCGAAGAGAGAAGCAGCCGTGAACCATGCCGCCCACCAAG
CAGCGAATGCGCCAGCGCTTCGGGCCCAGCCAGGACTACCTGCTCGTCGTGCAGGTGAACACGGACCAGCCGTTCCGCGCGCCCTACGGCGGGCTCATGG
CCGGCTGGGAGAAGGTCGCCACGACCCTCAACGGCTGCAGCGCCTTCAAGATGCACCACCTCAAGGGACCCATCGCCAAGAACCGCTTCGAGCGCCTCGT
GGGGCGCCACCGCGAGTGGGTCAAGAACGGCAGCCACCCGGGGGACGCACCCTCGCAGGACGCCTCCTTCCAGAGCGTCATGGCCGAGCTTATTCCCAAG
CTGGACGCCGCCGAGGCCGAACCGCCGTCGCAAAATCTGGGCAAGCGCGGCCGCCCCAGGAAGATCCGGCCGGAGGACGGACCCGCGGAGAAGAAGCCGG
CACTGCAGGCCTCGCAGGTGGCTATTGCGCCGTCCCCGCTGGGTCCGCAGCCGTCGTCGTCGTCCACTTCCCTCCTCGTGGATTCCGAGGACCAGGCGCT
GCCTATTGTGACCAAGGCCACCCGCCAACGGTTCACGCCCGGAGACGACCTCTTGCTCGTCAAGTACGTGAAGGAATCGCTGCCTTTCCGCGCCAAGTTT
GGCGCGATCTCTTCGGCCTGGGAAGACGTGGCGAACAAGCTTGACAACAGCCCCGACTTCTCCAAGGACAATATTAAGGGCCCGATCGTTCGCTATCGCT
TCGAGAACCTGGTGTCCAAGTACCGTGAGCGCGTCAAGCGCAACAGTGGGCGCGTTGTCGGCCCCAAGGGCGCCCCTGCGGGTGAACTTGAAGTACTCAT
GACGGAGCTGGTCACGCTCCTGGATGGTGGAGACCCCGTGAGCGCCGCCCTGCTTGCCCAAAACGTGGCGATCGCGACCGGAGCGGTCAACGCGGTGGCA
GAACGTGAGAATCAGCGCACGGCTACAAGCCAAGACGAGGACTCTTCGAGTAGCACGAGCGAACCGTCCTCGCCAGTTCCCGCCCCGGCTTCGGCTGCGA
CCCAGAGCTTCATCACCCCCACAAGCGAGCCCGAGCCGGCATCAAGTGCTTCGTCAAGTGCCCCGCCCAAGACGTTGAAGACGGCGGCGATTTCTGCGGT
CTTGAATGACATTGACCCCTCAAACATTGCTGAGCTGAAGGCGCTTCTGCAAGAGATGGTGGAGCAGCAGGCGCGGGCTACGGAGCAGATGCTGCTGCAG
CAGCGCGAAGAGCGCCGTCTCGAGGCGGAGCGGCGAGAGCGGGAGCTTGAGGTCGAGCGTGAGGAGCGCGAGAAGGACCGCCAGGCGCTGACGGCCACGG
TGATGTCGGCGATGAAGACATTCCTCGAGCAGAACGGCCGCAAGGACTGAGCGAGGGTTTGGAGGGGGAGAGTTTGTAGTTGGTAAATCGGCGCTATCTT
CTTAGGAATTCTTTTAGCACACACCGGGTTCATAAGCCCGTGTCCATTAAGTCCACCGTGCGAGCGGCTTGGACACTTGAATACCGGCGTCAACTTCAAA
GTGTATCAAATCCAGCTGGCATCAGCTTTTTTCCCTCTGACCCACTCCCAATAACGTCTCTAAACACATCGAGAAACACCCCGAGAACGACCATGCCCGA
CAGCGCCAGCTCATGCTTCGCCCGCTCCTGTTGCGCAACGTGCTTCGCTGGCAACGCGGCCTCCGCGAACGATAGCAACCGCCGACGCCTCGCCGAGGAC
GATCCTCGCCGCCGGGACCTGGCCAGCTCGCGTGACGTTACCGTCCAGCCCGTCGTGATGTCCCAGATCCGCCCGCCGCAGCCCCAAGTGCGCGCCATCG
ATTGATGCAGGCCTTGGACGTGCACGTAGGAGAGGAACGAAGAGAGCTGGAGGTATGTGACGAGGTGGACTTTCACCTAAGGAGCACGTTGCTTGAAGTG
ATGCACTCCTTCATCGCGTGAAGTGGGAACGTGCGAATATCAGGAAGGACCAGCACAGCGAGGATAATGAAAACAGTGCATTGAATACATATTGCATCGC
TAGCGCAGAATCTGCGCCGCAGTCTGCGGCCCGCAGATAGCCTAGCGGACGGCCCCGGCGCCTATAGTGCGATTACGATACGCGCAGGACGTGGGTAAAT
TTCAAGCATCAACAACTTGGCGCGTTTTTGCTGTGGCTCGTGAGACACAACCGACATACACTTTTCAAGTGTGCACACGTCGCAGAATGATGCAAATGAA
AAACTCATTCGAATGGCGAGCTTCTGGCAGGCGCGACTTGAGGAGAGGAAGTTTGATCATTGCGAGAATTTCCAATAAGCCCTCAAGCCAAGAGATCGAA
GAGAAGAACGGAAGCGGGAGCCAACTGACCTGAAGACCTACCAAGCTCAGGCCCAAGCGACCAAAAGAAGATAAAGACTGACCATGTGCGGACCTGACGA
TGGCGGATGTGATCTCTGCTGCGCCGACGAGTGCTGCGGGTGCTTGGCCGGTCTGTGCTGTGCCTCGTGCTGTCTAGCAGGCGCCTCGGCTGCAGACAAC
GACGATCGACGTCGATATGATTCGCCCAGAGAAAGAGAAGTGTACGTCCAACCTGTAGTCGTGCAAGAGTACCCGGCTCCTCCGCCTCCCGGTTATGGTC
CGCCACCTCCGGGATACGGATATGGACCGCCCCCACCTCCGCCTCACCGTGAATACTACTGAGTGTGTAGCCTAGTTGGGCTCTACCCACAGTAGGGAAG
TACGGCACGCATGTTTCCTCATGAACACTAACGAGTTGTCAAGCAGTGACGCCGTCATAAATAAATAAACAGTGTTTATACTCCTCCACGTAGTAATATG
CATCGCCAAGAGTATCGTTGCTAGATGCACATAGTTGTCTGTTGAAGTGTACTGCAAATGCGTATATCTTGCCTTGGACGCCTTAGTTGAAGTGCCTCCT
CAGATGGGGGAATCAGAATCCCATTAGCAATTAATTGCTGGGAAGAATGGGAGGCAAGACCGTTGTGGGCACGCGACTGCACTGGCACAGCCACTCGCAG
CGCGAGCGGATCGACGTCGACAAGGTGCTGGGGCAGGTGCGGGCGTTTTGCGCGCGCGCAGCGACGTACTCGGACGGCGGCATCCTGATCGCCGTGGGGC
TGCCAGCAGCGCTCGCCGACTCCATCACAGCCGCTCGTTCGTCGGATGATGCGACCCCTTCGTCCAGCGCCTTCATCGACTCTGTGCGCGACTTCATGGC
GCGACTGAAGAGCGACGTAGACTCAGGGAGCATGGCTGGCAACGTGGAGGTCATCTCGATGCTGCACTGGGGCAAGTTCGTGCCTGCCCTGAACGCGTTG
ATTGGTACGGCGGCTGACCACTTCCCCGACGCCGACACTCTGCTACTGCAGTCTCTGGAGATCAATGTGGACGCAGCGAGTGTGGCGTCATTGCTCTCTC
ACTTTGATCTCAAGCGCGATCTCGTGGTGGGCGCGGCTCTGCCTGGACACGAGTTTCAGCCGGATTCGGCAGCCCAACCGGTTGAGCTGAGCGGCTTGAC
GTCGCCGTGGAATACGCTGGCGCTGTGGAACTTGGAGCAACTGACGAAGGTGGGCTTTGCGCTCATGGGAGACGCGTTGCGCCTCGAGGTCGATGGGATC
GGATCCGCCGCGGGCATCGAGGAGGTCGCCACCATCGCCATGTACCAGCAGCTCTACGCGAACAGCACTTCACCCACGACGGCGAAGCTGGTTAGAGTGC
CCAGCATCGCGTGGCAAGTGGATGGACTTGACGACCCCGAGCGTCTCGCGTGGCACAAGAAGAAGATGGCGAGCAAGCAGCAACGCGCTGCGGCTCAACT
TGCCCATTTCGGCGGCGTTGCTCCAGGTCGCGTGTACCACTTGGAGGCTTGAAGTCGCCAGCATTGAGAAGTAGAGTGAACCCAGTAATAGCGAGCACCT
CGAGCTCCCTAATGACACTTGCCAATCTCGGCCCAAACTCGAAGTGATCACCACGATGTCGTTGCAGTTGCTGCAGTTTGCGGTCCGTTTCTGAATCTGT
CTGATCCCTCGCGATGTGACGTGGAAACGCTTCCAGTTCCAAGCAGCAGTACTCGAGCGCAAGACGGCAGCGGGCGGCATGAGGGGCACGACGGTGGTTG
GCACGAGGCTGCATTGGCAGAGCCACACGCAGCACGAGCGGATCGACGTGGAGAAGCTGCTGCGTCAGCTGCGCGAGTTTTGCGCGCGTGCCGCGACCTA
CGCGGATGGCGGGATCCTCATCGCCGTGGGACTTCCGGCCGCGACCTCCGCTACGATCACGGGAGCGCCGCCAGCGCCTTCTTCTCGCAGCGTCGACTCG
ATCTCGCCCACTTCCTCCAAAGCTACCAGCGTCTTTGTTGATTCGGTGCGGGAGTTCATGACGGAGCTGCAGAGCGAGGTGGCCTCGGGTGCTATTGCCG
GCAAGGTGGAAATCATTCCAATGCTCTACTGGGGGAAGTTCGTGCCGGCGTTGAATGCTCTCGTTGGTACTGCGGCTGATCACTTCCCGGAGGCCGACAC
ACTGCTGTTGCAGTCTTTAGAGATCGAGGTTGACGCGGCTGGGGTGGCGTTGCTACGCTCGAACTTCGACCCGGAGCACGATCTCGTCGTGGGCACGGTA
CTGCCCGGCCACACCTTCCAGCCGGATCCAGCGATGCAGCCGCTGGAACTGAGCGGGCTGACGTCGCCCTGGAACACGCTGGCGCTGTGGAACCTGCAGC
AACTGACCAAGATTGGCTTCGCGCTCATGGGCGACGCATATCGTCTGCATGTTGAAGGCGTCGGGCCCGCCGGCGGAGATGAAGAAGTGTCGACCATCTC
CATGTACCAGCAGCTCTTCGCCAACACGCCAGCCGCACCCACAAGGGCCAAGCTCATCCGAGTGCCCGGAGTCGTCTGGCAGGTGGCCGACTTCAAGGAC
CCGGAGCGCGTGGCCTGGCACACGATGAAAATGCGCAGCAAGAAGCAGCGCACGGCGGCGCAGATGACCAACTTCGGCGGCGTGGCTCCAGGCCGCGTGT
ACCACATAGAGCCCCGCAAGTAGAAAGATAAGCTTATCAACAAGATACAGCAACATGACAAGCCCAAGCTTCAGCTTGTTGTCGTTGCTGTTCACGGCAA
TCTGCGACACTGCGGGACGACAGACAAGATTACATACTTTACGGTACTGTCTGGCGCCCTCTTGAAGCCAAAGGCTGAGCGACAGACGACGTTACGAGGC
GAATGGACTCGGGCGATGGCATCCAAGCGCGCGCAGCCTCTCTGCGCAAGGAAGCGGCTCAGCGGTGGCTCGTGAAGGACGAGCTGGTGTTCCTGCTGCT
GCACCACAAACTCGTGGGCGTGCCGGTGCTGCGCTCGCTGCAGCTGCGACCGCCAAGTACGTCTCACGTCGCGTCGCGCTGCTTCATCTACTGCAGCCAA
AGACTCACGCTCTGCTGCTGTGGGCAATGTGGTCACTGACTGACTGTCGATAGGCGGCACGCTGCTGTTCTACAATACGCTAGAGGTCTCGGACTACAAG
AAGGACGGGTGGCACTGGCAGAAGCGAAAGGATAAGAGCGGACGGGTGCGGGGACGACGCTGTGGTATTGGGAGTCGCTGGAGCTGAGAATTAACTAGGT
TGTGTGTGGTGTGTACCAGGTTCGCGAGGACCGCGCGAAGCTCGTGATCAACCGTGAAGTGATCATTCTGGGCACGTATGTGCACTCAGCTGAGACGTCA
GTAAGTCCAAGTGCAGAGGATTAGTGGGAGGAGATATAGAGAGAGGCCTTGCAGGTGCTGACGAACTCTGGTTGTAGACATTCCATCGGAGAATCTACTC
GGTGCGCGATTCGAAGGAGAACATCATTCTCGTCCATTACTTTGACGAGGTAAACAAGGAAACCGTGGGACGTCAGATGTCGGCAGATGTGTCCAAGAGC
AGCGTGAATAAGGGGGTGAAGCGGTCGTTGCCTGTTGCTAGTACCAACTCGACAAGCGCGATACTGCCACTCAGGCAACCGAGCCCACCCAAGCCGTTGT
CCTCTGAAGAGACGGTTGAATCCATCATGAAAAGTATGCAGGTGGCCAGTGTATCGTTCGTTAGATCATTTTGTCCTAACCTTTGGCTTTACTTTCTGTT
CTCCAGACTGTTTTGAGATGGACTTCGAGCCTCAGACGACATCGTATCAGCCTTCAGCAACCCACCTCTCTGATACTGATCTGCTGCTGCTGAAGGACAA
CGTCATGGAAGGAATTACCTCTGAGTTCGGGGCCGACGATTTATTTAACGACCTAGCTCCTGCTACGTCCCCGGAGACGGGTGTTTGTGGGCTTGGAGGT
CAGCAGACATTCGAGTTGGCTGAAATTTCAGATTTTTCACCGGACTGGGACTTTGGAGATGGCGGAGCCAAGATCTTGCTCTGTCTTGCAGCAAGGCTTC
CGGAGAAATCGGCTCAAGATCCCACGAGACTCTTTGTGCAGTTTGGAGGCAAGCGAGTGCGCGCAGAAAAAGTCTCGGATACCGTACTTCGGTGCACTGG
TGCGTTCTCATTGTAATTTGTGAGGAATACTTCTGCTGGGTTCTAACTGCGTCTGGTGTTTTTACGCAGCTCCTAGCTCACGTGACCTCGGCAGCGTCGA
CATCTTCGTGTGCCATTTGGGTGGGCCATCACAACAGACATGCATCCAGTTGTCCCACAAGAAGCAGTTTACGTATCGAAGTCACTACCAGGTGTCTCCT
TCACTTGTTGGTGAAATTGCCAAAGAAAAACGTCGCTCAGGAGCAGCAGCTATTGACCCTCTGGAACTGACAGCGCCGTATTCATCGCCCGGGATTTCTG
GTAAGCGAGGTCGATCACCAACCGTAATATCCCGAGCTACTGGAGGTCCAAAGCGATCAGAGGAAAGGCTGTCTGGTTCTAATAGGAACCTGTCTTCCTA
CGTCGAGTCGGATTGTAAGTCAATTCCCATGCTTCGCCTGCCTATTTATTTTGTTCTCCACTCTAACGTTTGTTGATAACCTTTGTTGTTTAGTGGACGA
GCGGCAATGCAAAATTCGAGTGGTGGAGCGGTTGTCCGAATTTCACCAAGCAATACGAACAAAAGCAGCGGAACCTGCAGCTAAGGATGCGGGAGCTCTG
CCCATTGCTTCCGGCCGTAGTAGCGTGGAGAAGAACAGATCTGGAGCCGAGCACAACTCCTCCGCACGAGCTATGCAGTCGTCTCCGGGGCTATCAACTA
GCCAAATACAGCACACCAATCAGGAAAATCTGTCAGGCGAGGCTGCAGAAACTCCAAGTACGTTGGTATCATCCAGCGGAACGTCAATTGCGTTGGACGA
CTGTACAATTGAAGCATTGAGCGACAACGACCTGGAACAACTCTCCGAGAAACTACTGGAGCGGGTAGTGCGCCAACTTGTTACAGTCGCGCACACGAGC
GAAGAACTGCTGGAGGAGCTCAACTCGCTGGATGAAACTGGTCTGAGCTTGCTGCACTACGTGAGCTTCTACAACTATTCACAGTTGGTGCCGGTACTGG
TTGCTCACGGAGCACACATTAACCAGCAAAGCACTCAAGGCCAAACAGCACTTCACCTAGCAGCAGGATGCGGTCACGATGCAGTGGTTGATGTGCTACT
GCAATCGGGAGCAGACTTACAAGTTCGCGATTTTGATGGGCTTACTGCTGCCGATCGTGCTGAAAAATCAGGTCACGCTGACGTTGCTGCTAAATTGCAC
CGGCACATGGGAGATGATACTTCTACGGATATGGGTGTTGTCGACGAGATTTACGGGTTTGGAGGATCACCGATGGAGATTGACGACGCCCCGACACCCT
ACATGGATGCTGGAGACATGGGCCTTTTGGAAGGCAGTAGTCATGTTGTCCCCACCGTACGCCCACCCCGTTCCCACTCAAACAGTTGCGAGAGTCCCTG
CGAGGCAAGTTTAGCGTCTAAGGCAACATCATACGTACGTCCTCGGCATATTGTGTGTTTAGCGGCGAATATACGGGTACTAACCAGTGTGGCTTTGCTG
TGAATTTGAATCGCAGGTGGGAGAAAACCAGGAGCACAATCGGAAGCTCTTGCTGGGGGCTTTCTCGACCATGAGTTTGCACGATAAGTGTGCGCTTTCG
TTGAGTATCTCGCGAGACTCGGCTGGCCACCCTACCCGTCGTCGTGAAAGCAGCGTTGGAGACGAGATTCTGGTTTCTCCCAGCAGCAGCACGGGGACGT
CGGCAGGCTTCGGTTCGTCCCCAGCGAGCATGGTCGGCATGGACAGCAATCTTGTCGGTGGCCGATTGATGCTATCTGGAACAGAGAACGACTCCGATGT
TCAGAGTGTAATTGCTGAGGATGAGGAAGGCCTCAACAAGCTCCAAGCGGCTATGGAGCTCATGGGCCCAGAAGAAAGACAGTCGCTAGAAGACGAGGTG
AAGGTTCTCCAGCACGGTATCCGGGCGTGGTTGCTCAAGAGGAACTGTAAGAACATGCGCGAAACGACCAAGCAACTGCGTGAAGCAACACAAACCATCG
AGGATCAGCAAAAGCAGCAAGAGGCCGCAGACCACCGCTCCATGGTGGCTAGCGAGTTGTCAGAGCGAGAGCGTGCCGCCGTAACTGTCCAGGCGGCCAC
GCGTAGTATGCTCGCTCGCCGCAGCTTCTTGCAGACAAAACACGTTGCTATCAAGTTCCAGGCTGCCACGCGCGGTGTGCTGTGCCGCAAAAACTTTGCG
CGTATGAAGGCCCATGCACTAGCGTCGCTGGTCATTCAGCGCAACGTCCGGGAGTGGTGGAACAAGCAACCCGCAGCTACACGACCAGGAAGTCTCGATA
AAGTCGCTGACGTCGAAGAAGAAGATAGCACAGAAGAGAAAGCAGCGATACCGCCAAACACTTACGAGCAAGCATTGCATAACGGAGGGCTGCGCAATCC
CCAGTAAACGTCAGTATAGCATAGCATAGCATAGTCCCTCGCCAAAACACGAACTTCTAGCAGCACTTCACTCTCCAACTCGTTCTATTTGCCGCTTCCC
TGCATATCGACGGCTGTAACCTGCTCAATGAAGCTCTGACCTACTCCATCGCGTTGGCGCCTTCGTCCGTGTATCGCCGGAAGCCCGGGATGGGCGGCGT
CCAGGTGGCCATGCCGCGCTCCTCGGGGACGGGAGCCATGTCATCCTCCAGGGCCTCGGCCTGCAGCTCAGCGGGCAGCGCGTTGATGGCCTCCCACTTG
AGGTCGATCTTGGTCTGCACGTCGCGCATGAAGTGGTTGTGCTCGATGCTGCTCATGATGTTGTAGCGGCGGCCGATCTCCTGGTGGCGCTGCTTCTCCT
CCTCTGTCCACTCCTCCCTACAGTCATCAATGCAATAATTAATTCATTAGTCCTACCGTTACAATAAGTATGAAGTGAATAAACAACTGCAGGCACCAGC
AACGTACGCCTCGGGGTACTGGCCCTTGATGGCACGCAGCATCTGCTCGAAGTTGGCGTCGTCGCCGCCCTTCTTCTTGCCCTTCTTCTTGTCCTTCTTG
GTCGCAAAGCCGCGCACGCCCGTGGAGGAGGAGGCGGCCTCGGCCAGTGCGCAGGCGGTCGCCCGCTTGGCGGTCACGGAAGTCACGCTACGCAGCAGCA
GAGCCATGTCACTTTGGTCCTCGGTACTGTAGCTCTTGGAGTCTCTCGACCACAAGTGCGCCGGCAGTCAAAGCTGTCTATCACTAAGTACGAAATAGAG
T