Description :
From Genome Similarity Track
Location :
Scaffold_19:490653- 509840
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_22165Hypothetical protein
Sappa_CBS223.65SPRG_19926Hypothetical protein

Sequence
19187 bases(100 bases per row)
GCTCGTACGTCAAGCACCTCCAGCAACTCGCTGTTGCGACCAAGAAGGAAAAGCACAAGCACGAGCAGCGGCTCCTTACGGTACGAAGTGTCTCCAAGAG
CCAGCGCAAGGTGAGCCCGCCGCCGCTACCGCTACCGACGCAGAACTGCATGGTCCTCGGGTGGGACATGGCGATCGCGCTCTTGCGAGCAACGCGGCGC
GAAGGCGGCGACACGTACCTTTCTGCGCTGCGCATGGTCCAAGACAACATGGCGACGCTCAAGCCGATGGCGTACCTCGACGGCATGTACCTCTCGCCAA
GCGCGAGTGCGTCGTTCAACCAGCTCTGCGACTTTCTCATCGAGGCCGCGGAGCCTGTTTTGTCTCCGAACGGCGACATGGAGGCCACGATCTCGCGCAC
AACTATTTCAACACTGGCCGAGCTTGCTCTGGTGCGTGGGTCCCTTGCGTACCTGCTCTCGTCCGTGCTCTGGATGCTCTCGCGGTCACCGTCCACGACC
CTCGACGTCAACCACGTCCTCTCCAAGCTCTTGTCGATCAAAGAGCAGTCGCTGTATGGTATCTGTGAAGCATCAGGTGAGCTCTACTGCTGCGGCCAAA
ACTCGTACGGCGAGCTCGGTATCGGCGACGACATTGAACGCCATCAACTTACGCTTGTGCCGTTCGGTGGCTGGGACGACATTCGGCAGGTCGTGAGCGG
CAACGAGATCCTCGCCGTTCTCACCAACAGCGGCATCGTGCTCACAGCGGGCCTCAACAAAAGTGGCCAGTGCGGCCACGGCCACTTTGACGAGCGCGTG
ATGCTGCTCCGGCCAATCGAGGCGCTTCGCTCGCAGCGCGTTCGGTTTCTCGCCGCGTCCAACGGCTGCGAACATATGATTGCCGTCACAGACACGGGGT
TGGCATATTCGTGGGGCTACAACGACCGTGGTCAGCTCGGCCACGAGAACGTCACGACCAAGATCCATGTGCCCAAGCTCATCGACCACCTCCGTGACAA
GAAGGTGACGTTTGCAGCAGTGAGCTACCACCACAGCGCCGTGATTACGGAAAAAGGCGAGCTCTTTACGTTTGGCATGAACGACTGCGGACAGCTCGGA
CACGACTCGACCGCGCACCAGAGCATCCCGACGCACGTCAAGGCACTCGACGGTCACGTCGTTTCCATGGTGTCGTGCGGCTTGTACCACACGATCGTCT
GCACGGCCGTCGGCGAGCTCTACACGTTTGGCAAGAACGACTATGGGCAGCTCGGCCTGGGCCACAATCGACAGAGCAAGATCCCGAGCCTCGTGTCGAT
CCCGAACGAGTCGATTGCGTTTGTTACCTGCGGCTATTACCACTCGCTCGTCGTCGGAACCAGCGGGCGCGTCTTTGCTTTTGGCCGCAACGACTATGGC
CAGCTTGGCATTGGCACAAAAGTGCACCAGAGCATGCCGCACGTCATCACGCTTGCGCCGACGGTGCGCGTGACGCGCGCCGCGTGCGGCTGCTACCACA
CGGTCATTCTCTCCGAGCAAGGCCACGTGTTTGCGTTTGGTCGCAACAACAAGGGCCAACTCGGAAACCGCGGCAGCACCGACTCGCTCTTGCCCGTGCC
GCTCATGGTGCGGCCGGAGAAGAGCCATCGCCGCGTCCTCGACATCGCCGCTGGGTTTTACACGACGTCGTTGATTGTCGAGCGCAAGAAAGAGTCGGAC
GACGACGACAAGAGCGACCAGAGCTGGGTCATTCCGCTCTGTGGGCGCATCGACATTGACCGGTCCGGCGAGATTGAAGGCTTGAGCAACTTTGGGTCCC
TCTCGACGGTCGGCGTCAGCCTTACGCGCGGCGCATGGTTTTACGAAGTCGAGGTTGTCACGTCCGGCTTGATTCAAATTGGCTGGATTGACGGCCACTT
TCAAGGCAGCTCAGACCAAGGTGAAGGCGTTGGTGATCATGCACACTCGTGGAGCTACGACGGCAACCGTCAGCGCCGCTGGAACTCGGGGTCGTCCACG
TATGGCGACAAGTGGAAGGCCGGCGACATTATTGGGTGCCTCCTCGACCTCGATGCGTCCGAGATGCGCTACTTCCGGAACGGCATCGACCTCGGCGTCG
CCTACGCCGAGTTCCACCCGTCATCGGAAGACGCGCGCAGCGGCATGATGCCGGGCATTAGTCTCGAGCGCGGCGAGATCATTCGGCTCAACCTCGGGCA
CACGGCGTTTGCGTTTCCGCCGACGGCCAAGCACGAGAGCGTCGCCCGCGCGATGCAGTGCCCCGCACCCGAAGTATCGCTGTCGCTCGCACCGCAAGTG
CCGACAAACGCGCCCGAAGCGCTCCACGGGTCGGCCAAGGTGCTCGTCGGGGACCGTCTCTTTGTCATTGGTGGTATGCTGGGGAGCGATAAGGATGCTG
CAACGACCAAGGTGTGGGTCTGCCACCTCCCGACCAACAAGTGGGATCGCTGGAGCGACCTCCCGATCCCGCTGAAATTTCACCAAGCGGTGCTCATCGA
TGAGCACAACATTCTTGTCGTTGGTGGTGAAAACGACGCTCCAGTGTCGCGCCACCTCGACTTGTACAAGTGCTCGACGAAAGCCAACGCCGACGGTTCG
TTTCCGACATGGGACCTTATCCAAGGATCATCGGCCACATCACTACCCGTTGCGCGTGCACACCACACGGTCGCTGCCGTCCGCGTCCGTCTCGAGACGC
TTGTCTTTCTCTTTGGCGGCCGCGCCTCGGACGATACGATCCTTGGCGACGCGTGGTTTCTGTCGCTGGAAGACTTTGCATGGGCCAAGTTGCCGTCGTC
GATTGCACTGGATCCGGGGCCGCGCGTCGGCTGTGCGTCGTGCGTGGTCGGCGAAAGCGTCTATGTGTTTGGTGGCATCGACAAGGAAGACCGACTGCGC
GCCGATCTTTGGCGCTACAACACGTTTGACCGCGTTTGGCACCTCTGCCACGACGACTACATTTACACGCCCCGCGAGCACATGAAGGGCGACAAGATGC
AAGAGTTCAATCCGCTCATGCCGTCGGTCCGCGCGCACCACGGCATGGCATCGGACCTCGGCAACATTTGGATTTACGGTGGTGAGACGCGCAAGGGCGA
CGTGCTCGGCGATCTTTGGGTCTTCTCACTCACACGGTGCACGTGGGCGTCGGTCGATGTGGTTGGCGCCGAGCCCCTCGCGCACACCGCCATGTTTGTC
GCTGCCGGTCGAGTCTGTGCCCTTCCATCCGGTCAGGTGCCCGCGCCACTCGCCTGTTTTCTCTATGGTGGTCGCACGACATTGCTGGAAAATGGCATGG
CCGTGCCCACGTGGACGACAATGATCCGACTCTTGACGCCGTCGGCCGTGCACAAGCGCCTCGAGAATGGCCGATCGTCGCAAACGGTCGTCGGGAAGCC
GTCGACGGTCTTGGCGAGCTTGCGGGTGCACGCGGGCGATGCGCAGTGCCTCCCGACCTGTCTCGACTCGGCAAGCTGCATTCTGGGCCACCTCGACCGT
CTCCTTGGCAACGACGTGCCGCAATACGAAGTCGATGCGATTCAGCCGTCGCGCTGCAGCTATCGTTCGTTGTGCATTGACGCAAAGGAGCCGTCGTTTG
CCGCGTTGCACCGGCTCCTCTTGCTTTTGGGCACCAAGTACTTGGCGCCGCAGGGCGCCGCGTCGCAAGAGACGCTCTACCCCCTTTTGGTCGTGCTGCG
CTTGATCAAGTTCAACTTTTTCGAGGTCCGTACGCGTTGAACACATGCTGTTATTTTGACATGGTGATTGTAGCTCTCGACGTCGTGTTTGGTGCTCGAC
GACTTGGGGTTCTCGTCGGCATCGACAGAGCCAGGTGGTACGCTCTACTTGCTACGGGAGCTTCTCTTTTCGATTGCCGAGTACGTGCCACCTGCCGACA
ACAATGGTGTCGGAGTGGCCATCAAGAAGGAGACTGTCGCCGCGATCAACTGCGGGTTTGCAATCATGTTTCCGTCGCTTCTCGACCGCCTTTCGGTGCT
CACACGGCTTTTCAACGACCAAGCCAAGTCGACCGACGTCGCCAACTTGCTCTTGCCGATGCTCGTGCCGTCGTTTGCGTGTCCAAAGACACTGTTCGAG
CTCATGGCCGAGTCGGTCGACGACACATCGCTGGCGATCACGACGACGTTTGCCGAGACGCTTTTGCGCGCCCTCTGGCAGCAAACGTTGGCCGCAGCGC
CTAACACGCTCTCAGCGCTTGTCAGTATTGAAGCGTCGTCCGAATTTCAGTGCTTCCACGTGCTTTTGCGTGCGTCTCTCTTTTGGGCCGCGTCGAGTCT
CCACGGGTGGGCCATCACCAAGCACATTGTGGAGCGATTGTTGCATTACATGGCTCAGCTCGTCGACGCGCTCAAGACACCGTCGATGGTGGCGCCCGCA
CTTTTTCTCCAGCAGAGTTTTGCCGGCAAACTGCTTCCGTTTACGCTCGTGAGCCTTCTCAACTTGCCTTCGATTCGTCCTGCGTTTGCAAGCGCCGTCA
TGGACTTGTGGCCAGCGGTGCAGACGCTGTTAACGGCACTGCACGACCTGATGACGTCACTGCAATCTGGGTCCATGTCGCTGACGCCGTCGTCGTCGCT
CACACCAACGCTACCGGCGACGTTCCAAGAGGAGGCTCTGTATGGATCGGCGACGCTTCAGGTCACTTGTGCGCTTTTGGACGCGCTTCAAATACCATCG
AACCGCGTGCTGAATGGCATTGAGCTTGCAGGTCTGCTCTGGAATGCCGTGCGTGTGGGCAGCCCCGTGAAGCGTCTGCCGACCGCCAGTGTCCGCGACT
ATGACATGTACCGTATCGTGCTCTCGCCGGGTTTTGCCAACGTCTTTGGGAAGCGCAGTCTCCTCGTCGGGTACCGCGGCCACGCAGAGATTGACGACTT
GAGCGACACGCCGTATGACGCAACAAAATTTACGTGGAAGTTTGCGTGGGACACCCTCACGTGCCACATTGCGCTCTTGACGCCCAGTGTGTTTCCACCG
CCGGCGCCGTCGCAGGTCGTGTCTTCAACGATGCCGAGCCCCGAGCTCGCAGCGCACCTCGACTGGCTCCATGATATTCAAAGCCTCTTGGCGCATCTGG
GTGGGCAGTATGCATCGGCGCTCATCATTGGGGACGCGTCGGTCAAAGACACGCCGGCGTCGCTCGAACGCTGGATTCAGTCGCCGCTCTTCCGCGGCGG
CCTCGACGACGTCGAGAGTGAGGCCAACCGCAACGATCTTCTTTTGTCGCAAATCCTCACCAACGACGGCGCCGGCAAAAAGCTCATTGACAAGGTCAAG
ATGGCTGTTGATCCGGACGCGCACATCAACCCCAAGCTACGCGCGACGCGCCTCAAGCGCCAAGACAGCGTGGAGCGAACGCTCGAGAAGAGCGGTGGGT
TCGAGGCGGTGGATCGGGCTGTGCGCGCAACGTTCGCGGTTCTCGCCAAGCACAGCCACACGTCATACGTGAGCGACCCGCTCACGCGCGACGGTATGCC
GAGCGATGCGCTCGTGGATGCGTGGCGCACGGCACTGCAGCTTCGCCGATGGTATTAGTTCTGTTGCACGGCTTGCTAGTATAAATCGTGTCGTATAGGA
TCGTGCGGGAGCAACAAAAGCTAGCCGTCACCTTGAGGTATGCAATGAGGCTTACAAGGATGGTGATGCTTCAGCACGAACCATGTATAGTGACGGCAAG
GTCTATGGCGACGAAGCCGCCGAGGACTCGGAGGCGACCAAGGAGCGGCAGCAAGTGCTCTACAAGCAAGTGTGCGACCCGATCGTCGAGCGCGCGCGCC
TTTTGTTGCAGCTGGCGCCGGTGCCCGTCTCGAGCACTGTAGAGCACGGCTCGTCGCCGTTCAAGATCCTTCCGGGCATCTCACAGTCGCCATTCGACTT
TGCCTCGCGCCAGGCTGCCGACGCCTCGCCCAGTAGCAGTACTACCGCACATGGCGACTCGGACCAAGAGCAATGGCTTCGGCAACTCAACAAGCTGATG
GAGACCAAGTCGCTCGAGATGATTGAAGAAGAGGATGAGAAGATTCAGACGGACATTTTTGCGTTCCTCCAGCAGCCAGAAGGAGCGTCGTTCGACGCTG
ACATGGACGCGCTGCTTCGGAAGCACAAGCAGCGCGCGCAGCAACGCCTCCACGGACTTGAGATCTTTTCGCCTTGCTGCAGTGCACGCTGGGCATCCCT
TCGGCCCGATTTCACTTGCTGCCGACACTTGCCGCGTCGTTCCGGCGGTCGTCACCGAGCACCGACGGCCTCGCGACAATAAAAGTGCACTATTCGCACG
AACTTGAGCTCGCGGGTCGCAAGACGCTTGAAGCTATCGGGGACCAGTTTTTCACACTCGTAACGCACCTCCTCGAATCGTCGTCAGCAACGATGCTGCA
CCTCAAGCACGCGTACTGCAGCGCCGAGGCGCGCAAGCCGTCGGTCCACGCCATGCACGAGGCCGTCCAAGACGTCTTGCTGGCTATGGACGTGTGCAGC
ATCCCGTACGGACCACAGGATTGGCCGGCCGTGAGCCAGAGCTGTCTTCCGGCCTTCCTCACGGAAATGACGTCGTGGAAGGGTTGGCGTGACGTCTTCT
CGATCGAAGATGTGGACGACGCGACGTCCATCGAAACCGACACGTTCAAGCCTGCGATCTTGTCGGCCGGCGTCGGTATGAGCCATGTGCGCTTTCTTCA
CGGCGCCAACGTCACAGTGGACACGGATACGCACATTGCGACGGTGCTCAAGAAGCCGTCGAGTCCGTTCATGGCCGATGCGCCGCTGCCGACCGATGTT
GGTGGCCTTGCAATCGTCCAGCGCATCGTCACCAAAGGTCGATGGTACTGGGAACTTCTCTTGCGGCACCAGGGCACGTACCCCGTCTTTGTCGGCGTCG
GCAACGCCACGGCCAACGTCAATACACCCTACGTCTCGGAGGGTGTCGTAGGCGTTGCGTTTGCCAAGGAAAAACCACGTGCGCCGGGCTCCAGACGCTG
GCGTGGTCGCGCACGCACCCGATTGGTGTGCTCCTCGACTGTGACGCCAAGACGCTCGACTTTTATGCCGGGTACAAAAAGATGCACACGGTTTCGCTCC
AGGGACTCGCTTTGCTCGGCCTTGGCGTGGCCCCTGTCATTGGTCTCCTCGACAGCGACCTCCAGTGGGACCTGTATGCCCCCGTGCCACCGCGTATCTG
CGCCATGGGACCGAAGCTCACGACACCATTTGTGGCGGGTGGTCTCACGAGCGAGACGTTTGGCGGAAGTACGCTGTGCTGGAGCGGGCTCCTTAAAGGC
CCCAATCTGCAGCTCTCGGCCGACTGCTCGACGATCATTGCTGGCGACGTCATGATGGCGGCGCCCGTTCTCGAGTCGGTCGTTGCCAACAAGAGCTTTG
CGGACGGTCAGCTCTACATCGAGCTGTCTGTGCTCTCGGTGGGTCGCCGCGGCCACGGGCTTCTGGTGTTGAGTATTGTCGACACGGCGTTCTCTGCCGT
CCATAGCGGCTTGTTGGACCACGGTCTCTCGGTCGAATACAACGACGACGAGCTCGAGCAAGACCTCATGGGCGTTCTCTTTGACTTTAACGAAGGTCGC
ATCACGCTCTACCAGAAGCGAAAGGAAGCGCTGGTGTACGCTGTGGACCTCTCGCTACTCGAAGCGCCGTACGTGCCCGCGCTATCGTGTCTCTGCAACG
GGTCGGTCGTTTTGACCAACTTCCATCCTCGCGCGCGGCCGCAGCTGCCCCTCTCGGCCGTGTACCCCGTCGCCAAAGGCACGTATGCAACGTCGCTGGC
CACCGAGAAGCAAGTGGGAAAGAACCTCGACTTGCTCGTCGTCTCGTGCGACGGCGGCGAGTTCAGCGTCTCCCACGCGGTCCCGAACCTCTTGCTTGAC
GACAACTCGGTGTATAGCTCGTCTGTCGGCGCCAACGTCAACATCGTGTTGAAGCACATGAACGACACACCGTTCACCGTGACGTACGCCACGCTGCGCG
GTCCGGGTGCGGGCTACACGGCACCGCTGCAGCACGCGGCCGTCTTTGTGTTGAGCTCGCTCCCCGATTTGGAGGAGCTCGAGCAGTACAATGGATTAAC
ACCCGACGAGTTTGCGGGTCTCCCAGCCGCGCCAAAGGATGCCCACGCCAAGCGCGACGAGACGCAGCCCGTGCTCTACTTTGTGCTTGACGGCAACTGC
TCCCAAGTGTCCAAACGACTCGCGACGCCCATCACGGGTCGGTTTATCGTCGTTAAGCTCCTTCGTCCTGCCGTCGGCATGAACATTGACGTCGGGTACA
TGGGCTTTTGCGGCGCGTTCGATAAAGAGAACGGACCTGCGTACAGCGACTTGTACTGGGACGACTACATGTGCGTCGAGTGCCACGCGTGTCCCGTGCC
GGGTGTTTGCTACGTCTGCGAGGAAGACGAGACGGTGAAGCTTTGTAGTATTTGCTACGACGACATGCGCGGCAACGTCGACGCCGCCCACTACGCGTGC
ATTGCGTGCGAAGATGAAGATCGCGAAACGGCCACGTCCATCTTGTGTCCGACGCGATCGTCTTGGAACAGCACGGTCTTCGCCCTCTTTGAGCACAGCA
AGCCGTCGTTGTCGGGTGACGATGCCATGAGTGGCCTTGGGCATTTGAACGCCGAGCCCGAAGAGGTGTACGAAGACGTCGAACTCTTCGCTTGTGGCCA
AAACAACTATGGCGAACTCTGCCTCGGGCACTGCAACTCGACGTCCAAACTCGAGCACGTTCCTCTGTTTACATCCAAGAGCGTCAAGCAAATGACGGGC
GGCAACGAAGTGCTTGCAGTCGTCATGCGCGACGGTGTTGTGTACACGTGTGGCCTCAACAAGAGTGGGCAGTGCGGCAACGGTACTTTTGAGGAGCGCG
TCGTCCTCGCAACACCCGTTCGGTCGCTCTCGGGCATTCCCATCAGCATGGTGGCTGCTGCCAACGGCTGCGAGCACATGATTGCGGTCGCCGTCGACGG
CTCGGCGTACTCGTGGGGGTACAACGACCGTGGTCAGCTCGGTCTCGGCTCGACGATCTCCAAGTCGCACACACCCAAGCTCATCGAGTCGCTTCACGAA
AAGTACTTGATTGTCTCCGCAGGCGTGAGCTACCACCACAGCGCCGTCGTGACAAGCAACGGCGAGCTCCTCACGTTTGGTATGAACGACTGCGGGCAGC
TCGGCTTGGACCACACGCAGCACCAGCACACGCCGCAGCTCGTCGATGCGCTCTCAAGCCAAGTCGTGACCAAAGTGTCGTGCGGTTTGTACCACACAGT
CATCATCACTGCGAGCGGCGACGTGTACACGTGTGGCAAGAACGACTATGGGCAACTCGGTCTTGGCCACGCGCGCAGCGTCAAGGTGCCGAATCACATG
AAGCTCAACCCGAGCGAGAGCGACGAGAAGGTTCTTTCGGGCTGGAGCGGCTACTATCACACGACGCTCGTGACGGACAAGGGCAAACTTATCACGTTCG
GTCGCAACGACTACGGCCAGCTGGGCATTGGCAGCAAGGAGCACAAGAATTCACCGCACGTGGTGCCTCTGCCGCTAGGTGCCCATGTTGTCTCGGCGGC
GTGCGGCTGCTACCACACGCTATTGCTGTTGGGAAACGCGCGTGTCATGGTGTTTGGCCGCAACAACAAGGGTCAGCTGGGCGCGGGCGCGCGCACACTG
CCGTCCGCGGACCTTCCCCTGCCGATCCCAACGTCATCCTACTCGGACGACGACGTGGTCGCGATCGCGGCTGGCTTTTACAGCTCTTATATTCTCACGG
GTCGCAAGAGCGACGGGTCGAAAAAGACGCCACCCAAAGACGAAGCAAGTGCCAAGGAGACGGACCAGCAAAATGTGTCGTGCGATGCGCTCTTCGAGTC
GCTCATGCGCGAGATGGACCGGAACGCGCTCAGCGAGGCCATGGACGAGACATCGCCATTGCTCTTGAAGCGCTCCAACACATCGAAGAAGCTGCCGCTG
CTCAAGCTGCTCTCGGGCGCGTGGGCCATGACGCGTGCGCTCATGTACCAGTCACTCCAGCACGTCTCGCACAAGGACAAGAAACCGACGGTAAACACCG
TTTTGCGAGGCTTCCTTGTTGCGATGCTGCAAAACCTCGGTGACGCATCGACATCGCACCAAACGCCGGTGCCGAGCCCACACCAGCGACTCTCGACCGA
GGACGAGGGTTTCTTCAACCTCTCGGATGCATGTGTCGGACTGATCAAGTATGGTGCGTCCGAGCAGAGCAAGCCCGCGGATGGACCGCATGTCCTCTCG
CAACTCTTTAGCAACCAAGTGCTTTGGGTGCTTCTCGCATGCGGCTCGGTGAGCTCGGACGTGTGCTCCGTCATGGCGTCGAGTCCGGTCGTGCTACGCG
AGATCGTCTCGGGGATGCTGAGCTCGACATTATCGTCGTCGATCATTTGCATGCGACTGAGCATGCTCCTCTTCCCTCTGCAGTCGGTCTCGTCGGTCAA
CAAGGTCTTTCGATCGCTGCCGTCGGTCCACGGCGCGTCGGATATTGTGTCGTTTCTATTTTTGCTTGTGGGTGGTCCGATGCTGCTGCGGCCGACGCTG
TGCAAACACGAGATGGGCCTCGAGTCCGCGTCGACGACACTTTGCAACTACTTCAACTGCAGCAAGGGCGTGTCGGGGGACGCCACGATCCTATCGGAGC
TCCACCATATGCTCGAGAAGCACCACACCAACCAAGCCAAGTCGTGCGAAGCCGTGTCGTTGATTCGGTACCTCACGCTCTTTCCGACATGGAAGAAAGC
GGTCGGTGCGATTGTGTCGCGGTCGCTGGAGAAGACGGACCTCGTGGACGAGCTCTTACAGACCATCACCAAGTTTTACGAGCATTTTGCCGACGCCAAC
GAAGACAATGTGTCGCTGGGCGTTGCCAACGACGATGAAACCACACCGACGGAGGCCAGTACCGTCGATGCCGTGCGCCAACCCGAGACGACGTCTCCCG
AAAACGACGACGACGACGGCGACGCCCGCGGGACGCCGCACGTGGATGAGACCAAAAAGAGCGCGCGATTGACGTCATTTCCGAGTCGCTCTCGTTTGAT
AAGAAGGCTGCGGCGCTGCGCAAGAAGGCCCGGGAAGCATTAGACCACGCGACGCTGCTCATGGCTGCGATCTGCGTCGTGGGCGGTCACACGGAAGTGC
TTCGTGAAGGTGGTCACGTACTCTTTGAAGACCTCGAGATGCGCGGTCGGTACAAGAGCGGTGTGCTCGTCGCGCTGAAAAAGTCGGCGCGTGGCGTCAT
TGACGGCGCGGTTTCGCTCTTGGAAAATAGCGAGGCGATGTCGCTGCCAACGTTGTGCGTGCCGCTCAAGAGTCTCCAGGCCGTCGAGCGCATTCCGGCG
ATCCCCAACATGTTTGACGACCACCTCGCGGACGCGCTTCAGGCCTTATCCAAGCTCATCGTACCCTCGGGTCCAAGCCCGCTCACATCGCGTCAGTGTT
TCAACCCCATCGTCCAAGCGATCCTCGGGCCTATGCTGAAGTCGTACAAGAACCAGATCCGGTGGCGGTCGACCAAAGCGCTCTCGTCGATTCTAAAGCA
GCTGCCGTCGCTCGACACCTCTATGAGCAACAACCTTGACGTAGCCATCGTGTCCAACATTGCGTCGCTCCTCGCGGCCGAGAATGCGTTCCGCGTCCCG
AAAGTGTCGGTGGCGAACGCTGCTGTCGAGGACCTTGCGAGCCTCCACTCGAAATGGGTCTGCGTCACGGAGCACCGAACGTACTTGGCAGCCGAGAACG
TCATTGACGCCGCGCTGGATGCGATTGAGGGCCATGTCCGCGACGACGTTGTGCGCAAGCTCGGCGACGAGAACGCGCTCAGCTGGGGCATTGACGCGAT
CCAGAGCCCGAAAAAGCGGTCGTCGACCGTGTCGTTTCACACGGCTGCGAAGGGCAGTGCCACCAACGACGCATCCCACGACGTGCCGCTCGGTGTCTGG
GGCATGCTTGTGCCCGTGCAAAACACAGCCTCGGCGACCGAGGAGACGCCGTTCACGTCCAACTTTCATCTGCGGGCGCCGGTGGTGCGCGTCGGACGTG
CGACCGACTCGTGCGACATTGTCATCAACGACCGCAGCGTGAGCGGTCGGCATTTCCATTTACGCCGGGCGCGCCAAGATGCGTCCAACGAGTATTACGA
GTTGCAGGATTTTTCCAAGAACGGCACCATCGTCAATGGTGTTCGTGTCCACGGGGCGAGCTTGCGGGTTTCGCATGGCGCGCGTATCTCGCTCATCTTG
TCGCGGGGTGGCATGATCACGTACGAGTTCCACGTCATGTCGTCGCAGAGCAGCGCGCCCGTGCTCCTTGACGCACCGTCCACGAGTGGCGCCAGCCTGG
CCTCGGAGCCGCAACAGGCACAGCAGCTCGAGTTTCAAGAGCCGCGAAGCCCGGCTGAAGTCCAGAACCGCGGTATGATGAGCAACATCCGTGCACGCCT
TGGGCCGCAAGGCTTGCGCCTCATCACGACAATTGGCGACTCGGACCTCCCACGGGCGCTCATTTCTCCCAACCCAGCTGTGGACTCGCCGCGTGCCGCG
TCCAACCCGCCGCCGATCGCAATCTCGACCCACTCGCCGCGAACACCGGCCATTGGGTCACCCACGCACCTATTGCTGTCGCCGGCGTCGTTCCAGCAAC
GCGAAAGCAGCGACAACGGGCCGGTGCCAGCCATGGCCATCAACGAAGCGTTGCGCATTGCGTTGGGTCGTGACAGCCTCAGTCGCGATGCCATCATGAG
CGACGTCTTGGCGCGCACTCGTGTCCTCACGGCGTCTGGGGACATTGTGCCTGCGAAGAAGACCACGGTACTGCACCTGCCCTCTCTCGACAAGGTACAG
ACCATATGCCAACTAGGCGCCCAAGCCGCTCGTGGAAGCGGCCAAGCTCAGTGTCAGCGACATGGCGCGTGATTTGTACAAGCGTGTGCGCGACCTCGGC
GGCCAAAGCGTCGAGCTGGAGCTCTGTGAGCGCGCGCTCGAAGTGCAAAATGGCGATGTTGTCCGTGCGCTCAAATATGTCCAGGACCACCTTGGCAAGG
CGCAGGTAGCGGTAGTTTTCTGACAAATCTCGGTGGTCATGATATCCCATGTAGAGTCTGGGCCTCAGTCCGCAGCACCACTTGGCGGCGCGCAGCCTTG
CCCATATTGTGGGTCAAAGCACCACCGCGTGCTCGCATGCGCTCAAGCAGAGCGGCAACAACATTGGCGTCGCCCTGCGCTCGCTCCTCTTCAACAGGAC
GGCGCACATCAGCGAAACAGTGACGCAAGAGCTGAGCCACGAAGACGACGATCTTGTCTCGGACCAATTTGACAAGTTTGTGTCGCAGGCCGTGGACCAA
CTCGCAAGTACGGCTCACGACGCCTGCGAGGAGAACCCGAGCTACCGGCTCCTCGAAACGACGGCGCCGTCAGCGTCGTCCCCGCGCCGGTCGATCGCCG
CGCGTTCAAGCCCGATGCGTCTCTCGCTTGCGAAAAGCTCCAAGCGCGACGACGTCGTGCCGTGGAGTGCGTGTACCGCGCACATGGACGAGCGTGTTCG
GTTGCTCAACTGGCGCGAAGTCGACTACGAGGAAGAGGTGTTGGGTCACATGCTCTGCGCGACGCACGCACGCAAGCTGCTTTTGCAAGTGATTCGTCTC
CTCCAGCCCGTACGTACCTCCTTTCTCTCTGTCCTTTTCATGGCCAAGTGTCTCTTGTAGCACCACCAAGCCAACAAGCTCGACGAGAGCAGCCCGCTGT
GCTCGTTTGGCGACCGCAACACGCTGCGGCAGCTCGTGCTCTTTCCCGAGCACGCGCCGGGCGACGAGAGCCTCGATGAGCAGTCGCACCACCGACACAC
GCAAGGTCGCATCCAGCAAATCCTGGCGCGCATCTCGTCCGACGTCATGGCGTCGTCGGCGGCGCGGACGCTCGAGGCCAACATGCGCACGTTCCAGAAC
GTCTCGACGCTCGCGAGCTCCATCGACAAGACGGATACGCTGCTGGCATCGCATGCAAACCACAACACGGTGCACGAGGTCGTGCGCACGCTCCTGCTCT
CGACGACCGACGACGTGGCGACCAAGCACGCGATTTGCGAAGACTTGGTGCTCGACACGATGATGCACGTCATCTCCAAGACGTTTAGTGCCAAGGACTA
CGAGTCCAAGTCGCGTACAAGCGCCAGCAGCAGCCACGATGGCAGCAGCGAGTACCCGAAAGGACCGTTTCTTGTTTCGTCGGGCCTTGAAGTCACGATC
GTCGCGTCGTACGAGCGCATTTGGGGCATTCCGCACCCCGACCCGCTGGTGGTGTACCGCCACAAGTGGCGCAAGAAAGGCGGCTCGCTCCTCGAGAAGG
ACGCGCGTGTGCCCTTTGATGTCGGCGTCACGCTCTGGCGACCGGTCTTCCCAGCGTCGTTCCAGACGACACTGCTGGCGCCGGAAAAGTGGTTCGCGCT
CGGCGATGTGGCCAAGGCCGGCAACGACGCGCCATCGACACCGATCACCCTTGTCCGCGACAACAATGACGGATGCCTCGCGCCGCCCCTCCGCTTCGAG
TGCGTTGACGTGACGGGGAAAGGCCTTCCCAAGAACTCGGAGACGGACACGGAGTTTGAGCGCAAGCAGCTGCGCTCGATGTGGTGGCCGATTGCGCCGC
CTGGGTACGTCGCGATGGGCTGCATCGCCGGCAACAAAGAGGCGCCGTTCGACCCGCCGCCAGTGCAGAGCGTCCGGTGCGTCCGCGAAGACTTGGTTCA
GTGTCTCGACAGCGCTACATGCGTATGGCAGACGCCGAGCGTCGCGCTGTGGTCGGTCGCCGCCGACTACTCGGCGCACTTGATTGCGACGAGTCCGCAA
CTGTCACCGCCGACCGCCGTGCCGGTGCTCCAGCTCTCGGACGACGACCGCATCTTGTGCTCCCCCGTGACCACCGCGACAGTGCTTCGTTTTGTCAACG
TTCTCTTGCACGCCAACCAGTGTCTCGGTAGCGCGGGATCGATCCTCGTACCGGAGCTCACGTCTGCGCTCTTTGTGCTGGTCAAGCAAGCGCTCTCGGA
GAAGCGCAGCTCGCACATCACGATCGAGCTCGTGCGCGCGCTTGCGACGCTGATTCGCCACGGATGTCCATGGAAAGACAAGGAAGGCGTACTGTACTGT
CGGTCCAAAGTCATGTTTTTGCACCAAGACCAAGAGGGTAGCTTGATGCTGAGCTCGCTTCTCCAAGCACTCGTCGAGCTTCTCTTGGTGGTCGACAACC
AGAACCGCGCCGAGAAACTTGCGATCTTCAAGCAGCTACCGCTGTACGAGACGACCGCCACGCTACCGTACACGCTGCATCGCACCGGGCTCGAGGCGGC
GTGTGCCCCAATGCATTCACCCAAGATTCACATCGAGGCGGGTGCCATCAGTGGCGAGTGGGCAATGCAGTACGCAGCGTCACCCGAGGCCGCCAAGCTC
GAAGGCATGGTACCAGACGTTGTCTCGCTGCGTTTGGAGAGCACACCGCTTCTGCACATCTCTCTCCAGACCCGGGCGATTGCGACGCTTCGCTACTTTG
AGATTGTCGTCCAAGACGCCAAGCCGCAGAGCGCGCGGCCGGCGGGGTTTGCCCTGGGGTTCGCGACGGCCGATATGATGCTCGATGGGTCGTCGTATGT
CGGAACGCAGGCAAAGTCGTACGCGTTCGCGCCCAGCAGCGGCAAGACGCTCTGTGGCGATCCGCTCGCAGACGTGTGGCCATGGCCCGACGTCGCGTTG
CCGCCGACGCCTGGCGACATTTATGGCTGCGGTCTTCGACTGGACGCGCACGAGATCTTCTTCACGAAGAATGGTCGTCTTCTCGGCACGGCGTTCTCGT
CGATCCTCGGTGACAGCCAGCTGCAGCCGACAATCTCGATGGACTGCGACATGACACTACTGCTCCGCGTCCACGACCAAGTCGCGTTCCCATTTGACAC
GACCGATTGGGACGCGCCCATGGAGGGCTTTGAGTGGTTTGACCATCTCAGTCAAGTGTACGGCATCATGCACGCACTCGTCGAGAAGACACCACTGCCG
GACGAGTTTCTCCTCTCGGCCGACAATTTCCTCGCGTCGATTTCACGTGACGTGTGCAAGACGTTTGCAAGCGCGCATCCGTACGACCTCGAACTGCAGG
AAGAGACGGTGCACATTGCTCTTGCGACCTCGATTCGCATCAAGCTCGACCCGCTCTGCGAGACGTCAGGGTCACACTGCCTCCAGATCGCGCAGGGCAG
CAGTGACGAGACTGCGGAAGCCGAAGTGCGCACGTTCACCGGCGCCTGCGGTGGCCAAGAGATCACGGTGGATGGCAACGAATTCACGTGGCGTTTTCCG
GTGCAATCCAACTTTCAGTGCCGCATTGACCGACTCCGGAAAGGCCCCTACATCAAGCTGGACGCGCGGGATACACGGCTGTCGCTCACGCGCGACAAGG
GCTGGCAGTCGGCGATCGGCGTCGCGCGCTTCGACTCGGGCGTGCACACGTGGGAGGTCAAGATTTCCTTTGTGACAGCGTCGTCCAACATCTTTCTCGG
TATTGCGCGCAAGGACGTTCGGTTCGACTCGTACCTTGGCAAAGACAACCGCGGATGGGGCTGGATCGGTAACCGCGCGCTATGGCACAATGGCAGCAAG
CAGCGCGGTACGTACGGCGAAAAGTTCAAGACGGGCGACGTCGTTCGCTTGATTCTCGACTTGAAGCGCGGGACGCTCTCGTATGCGCTCAACGGCAAGG
ACCTTGGCGTCGCGTTCGGACCCGGTGGTACCGGGCCCAAGCTGGAGGGCACCTTTTACCCCGGCTTTGCACTCTACAACCAGCGCGACGTCATTGAGCT
CGTGGGCGGCCATCGCATGGAGGACAACGATGTGTCGCTCTCGCACGGCGCGCTGCACGTCCCCGACATGCATCTGCACGACGATGCCAGTGGACTCTAC
GGCAGCGACGACGACGATGGCGACGTCGAAGCCACGGCCGAGGCCGTGCCGAATTACCGCGTCGAGCTCGCGAGCGTCTTGAGCCAAATGGGTTTTCCCG
TGGATTGGTGCGTCTACGCGCTCAAGCACTGCGACGACGACGCGGAACAGGCCGCCGACTTTATCCTTGGCAACATGCACGCCATGGAAGCGCTCGTGCG
CGAAGAAGCCGAAGCGTACAGCCGCCTCCTTGCGACGCGCGAGGACGCTGGTGTGCTGCCGCCTCCTGCGCCGAGCATGGCGCTCGTCGACGCTGACGCG
CCAGACGATCTCGAGCCCAGTACCGTGTCCGAGCCCGCGCCACCGGTCGCAGTGGAAAAGTGGGGTGTCGCCTTCACGGTCGTGCCCGAATTCTCGGTCG
CGGGACGCCACTTGCTCGCACTCAAGTACGCGCCGGCGCTAGCCGCGCTCCATGACGCGCACGCGGTCTTTGGACGCGATCAAGATGAAGCGATTGTGAG
CTTGGTCAATGCGCTTTGCGAAGCGCGAGCTGAGGCATCTGTGGCGTGCGATCCACTGCGACTGCGACCGGACGAGTTTACGCCGACCGACGACGAGCTT
CGCGAATATCCGTGCTTGGTGGGGCTGCCGCTCGACGCGCTCCGGTCTCGCTTCCTCGTGCTGCGCAACTTTAACGCGCGGCTGCAGCACGTCTTGTCGT
TTATGGACTTTGCAGCGACCGAGTCGCAGTCGACGCTCACCAAGTGCATGCGCGAGCTACGAGGCTGCGTCTTCCAGACCGTCAAACTCAACTGGTGGTT
TAGCATTCTCAAAGAGCAGCAGACGCCAGCCGCGGCGCGCCCCGAAATCGAGGTTGATCGACACAAGGCGGCCGAGTCAACGTCCGGTGTCCTGGACTCG
GTCTTTAGCCAGTGCTTTGCCCAACTGCAGACGCTGCAAGGGTCGCTCCTCCGAGGCCATGACCGCGCCTTCAAGTGCCAATTTGTTGGCGAGTTTGGCG
ACGACTTTGGCGGTTTGTACCGCGAGTGCTTGGCGCAAATGAGTACGGAGCTGCAGTCCAACATGCTCCCGCTGCTGCAGCCGTGCCCCAACCAAGTGCA
CAAGGTGGGCGAGAACCGCGAGTTTTTCGTGCCCAACATCCACCTCCGCAACGACCCAAAGCTCATCCAAATGGCCGAATTCCTCGGAAAGCTCATGGGC
ATTGCGATCCGAAGCAAGACGCCACTCGATCTCAACTTGCCACCGGTCGTGTGGAAGTTCCTCGTCGACCAACCCGTCACGCGCGTCGACATTGAGTCGA
TCCACCACGGTTGCTTCCAGGTCCATTGGCATCTTCGATCCATGTCTTCTGGATGCTGATGTGAATCCTTCTTTCGTAGGTGGTCGATACGATCAACAAC
ATCACCAAGCATGGCATCACACCGGCCATGTTTGACGACCTCATCGACGCGTCGTTTACGGTGCTCTCGTCGGACCGGCGCGAAGTCGAGCTTGTGCCCG
GCGGCCGCCAAGTGCGTGTCACGTGGGACGACAAGGTATCGATCTATCATCATAGCAATGCACATGCCAACAAGGAGTTGTATATAGGACGAGTACGCGC
AAGCCGCGGAGGCGTACCGCCTCACCGAGTTCCAACCCGTGTGCGGTGACGTGGCGCGGGGTCTTGCGACCATCTTGCCGCTGCCGACGCTGTCGCTGCT
CTCGTGGCACGATTTGGCCACGCTCACGTGTGGCAAGGCGACGGTCGACGTCGAGCTTCTCAAGCGGCGCACGACGTACGGCGACGGCTGCAGCGGCTCG
GACGCGCACATTGGTTTCTTCTGGGACGTCTTGCGCGAGTTTACCGATGCGCAAAAGTCGTCGTTCCTGCGCTTTGTGTGGGGCCGGTCCCGCCTCCCGA
CGCACGCTGCCGACTTTACGCAGGACTTTAAGATCTCGGGCATGCCCAAGGCCGTCGGAAAGGCCGACACGTACCTCCCGCTCGCCCACACGTGTACGTC
TTGGCGATTATTTTTTTGTGCCGAAGCTCACGAAGGATGATGTAGGCTTCTTCTCGATCGACATGCCCGCGTATACGACCAAGGCGGTCATGCGGGAGAA
GCTTTTATATGCGATCACGCACTGCTCGGCGATCGACGCCGACAACACGACGGTCGCCCAGCGCGCGGGCCAGGGCCTCAACTGGAC