Description :
From Genome Similarity Track
Location :
Scaffold_50:49061- 51532
Transcript NameFunction/comments
Hyaar_Emoy2806394hypothetical protein
Hyaar_Emoy2806395serine/threonine protein kinase
Hyaar_Emoy2806396hypothetical protein

Sequence
2471 bases(100 bases per row)
AGGAACTGGCTGAGTTGGAGAGGTTTGAACGCGGGAAAGCAGGAAGCCACCTGTTAATGGATGAGCCTGTAGTGTCAACAGAAGCCCCGCAGCCATGTGG
TGAGGCGGGTTCAGGTGACCATTCACCTCAAGTACCAATCCGGATCACCTGTCTCGAGCGGCAGCTGCAACCGCTTCAGTTGCTGAACCAGCTCACTCAG
CGAGGAAGTCTTTTGGCCCGTTTTGACATCCTGGATGTCTCACCAAGCAAGGACGTCACGGAATTTGAGTGCAAAGGCTACCTGAATGACGGGTACGTTG
GTGCTGCTACTGCTATTAGCAAGAAGAAAGCTCGTGCGGAAGTCGCGCGACAGATGCTTGCAGCTGCTTACGAGCAGAACCTGATCTTCGTCTACGATGG
GTCAGCCGACAACGAGGATAAAGATGGAACTTATGATGGGAAAGACTTGGACAGGAACGAGCAGGGGTTAGCGAGTGACGGGTGAGCGAAAGTTATTGGT
TCATGAAGAGCGCGAGGTGTAATGAAGCGAGTACATCTTGTGAGATTGGTCTGGTGATTGCCTAGTTTAGGATCATCTCCGTAGTGGCGTTGGCTTAATA
TCTGCAGTACAAAAAGCTTCTGCTCTTGGTTAAAACCAAATGTCGGAGTCTTGGTCTCTTTCTATCTATATATTTATCAACAGTTCCTGCTTGTAACCGG
TTCTCGTCCGTTCATGGGTTTTGCTAATCTACAGACGTCAAACGCGCGCGTTCTTCTTCTCGCCAAATCTCCTACCTACCTAAATGCTTCAAAGCCGCTC
AATCCGCATGCACGTCGAGCGAGAGCTGATACACTTTCTGGGCCCGACGTGCCCGTTGAAAGTACATGACACTCGTCCCAAAGACGCACAAGTACAAGAA
CGACGCCAGGAAGACACTTGCTGCTAACGACGACTTGGGTTTGCCAGCTGGCGGTCGAACCTTAATATACAGCGAGTTGCTGGCGACCATGCAGCCCACG
ATAAACTACCACAAAAACACAGAAAAAAGAAGCACAAAGCACACAAAAGTCTCATATCCCGTAAGTTACTTGATCCATGATTAAAATCTTCATAGAAAAC
ACCACCAACACAACAAGATCAAAAAAGAACCACTACCACATCTTACGACGTACAAGCAAAAAGAAGCCAGTAAATGAAAGAATCGCACACCAAATTATCC
CTACCCAAGTATTGAAAACCCCACAAAAACACAAAAAAAGACACACAAAAAACATCCATTAGTCCAGCCTATTTTTCATCAATGGTGCAATCATTTACAA
CCAACGCACTCGCCCTCATAACTCCCGCTAGACGAGACGTACCCGGATGTGTCTGTGGTCCCTGACTCGATCCCATTGCCAGCAGCTCGTCCAGATCTGT
CGCTTCTCCAAGATCACTGACGTCACTCGGAGGTGACCCCACATGCAGGTGCTTGAGGTTCGCGTATTCGGCCGCTTTGCCGCCAGTAACGACCGCCACC
ATGTCTTTACGATCAAATGTTGCCGTCATTTCCTTGCGCAAGTCTCCGTAAACATCCTTCAAGCGCGACATATGGAGGGACACAGAGAAAGAGCCAGTGC
GCACGCACCCAGTCAGTGTGTCGATTACTTATGGGGTACTTCAGCCACTAGTGCGTGTTAATATGATTAATGGAATGTGACGTAAAAGACGGAATAATCG
AAGAATGGTGCTTACGACAGGACGGCGACGTCAGTTATGGGATTTCTCTGCGTGGTCGGGAGTGTGACGACCAAATGGCTTCACAGTCAAATGGCTTCAC
AATCAAATGGCTTCACAGTCAAATGGCTTCACAATCAAATGGCTTCACAATCAAATGGCTTTACGTGCTAAAAATAGATGATAGATCACCAAAGCGCAAC
TGACGCAGCTGACGTCACCCACATCCCCGCTAAGTCTATATGTCTATCGGTTGCTATTGGCTCAATACTAAAACAACCAACCGCAGCCTCCAATTTGAAT
TATAGCGAATCACAACACGACAACGAGCGACACAACCGCAGCCCTACCATAACATTCCCACTCGCAACCGCAACATTCCCACTTTATCTTTCGCGATCCC
CTCTCCCCTCTATAGAAGGATCTCCAGCCATTCACAATAGAAAAGACCTCTTCCCTCCTCCCTCATCTACCCCTATTGATCCACCGATGAGTACCCAGAG
CAACGTCTTCTCGGCGCTGCAGCCCGAGAAACGCAGCAAGAAAAAAGCCACCGACGCAGCGACGACGGCCACTCCCAACTCGATGTTCGCCTCGTTTGTC
AACAATCCGTCGTCGACGACCGCGTGGGGGGACGATAGTGACGAGGAGGTACACGTACCCCCTACCCCGCACCCTAACCCACCAGCTGGTAATCAAGAAG
AAGAAGAAGAAGATGAAGAGAGTGAAAGTGAAAGTGAAAGTGAAGAAGAAGAAGAAGAGAGTGTCAAGCCC