Description :
From Genome Similarity Track
Location :
Scaffold_1501:4905- 7514
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1501-fgenesh-gene-0.1Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1501-fgenesh-gene-0.3CDC5 cell division cycle 5

Sequence
2609 bases(100 bases per row)
CGAGGAGTGTGACGTGTCGCTCGCGGGAGGGAATGACGCCAGCGGCGGCGGCCTGCTCGACGGCGCGTCGCCGCTCGTCAAGCTCATGAACGACATGGAG
AGCAACATGACGAGCCTGTCGGCCGACAATTACCTCTTCTCGGACGACGTCGCGACCGCGAACCAAGAGAAGTTTGGCTACGTCTTCGCGCCCATCACTG
AGCCACTGCCTTACAAGCGCTATGAGCCAGTGCCGTCCGAGCTCGCAGGCGACTTGAAGCTCGTGTACAGGACCATGGCGTCTGCGGACGAGAACGAGAT
CGGCGCGCTGCTCTGGTCAAAGGCGATCCTGCTGCGCTGCGTGCTGGCGAAGAGCGAGGCGGTTGGCGGAGTGGAACCCGAGGCGCCCGTGGCAATCGTT
GTCCCCGAGAGGATTTGCTCGTGGTTGTTCAGTACAAGTGAGTGGCTGCTGTACCCTTGAATTATTATTGAACCTGCTGTCTTAACATTGTGACGTGTAT
ATCTTGCTTGTTCTCAGTGTCAACGCACAGCAGCAGCCACGTCGTGCGTGGCTGCCTGAGCAATTTGTTTATGGTGCTCGACCCCGTGAACATGACCACA
CCCGTGAGTCTAATTTTTTACTTTGAAAAATGGTGGAACTTGGTGGTGCTGATGATCTCTTTGGCTCTGTGCATTGATCCAAATAGGAAGTCCAAGCAGG
CTTGCCGAGCGCGGCGTTCTGCCAGCCGAACGAGGACTACCGTTCATTTTTTGGCGAGAAAATGTCGAGACTCCAGATGGCCTGGCAGCCGACGGTTTAC
GACTTCCTGAACGCGTTCCGCACCTTCGGATTCCAGGACAGTAAGCGCTCGATGAGCACGAAGAGCAAGATTGACGTGACGCCCAAGAGCAAGAAGCAGG
GGACCGCGATCCCCTTCCCGGCGCTCAATATGCAATATGTGCTCATGTACTTGGTGATCTGTCTCCGAGTCAAGTGAGTTAACTGATATGCGTTGTATGT
TTGTGAATAGAGACTAGGTACTAATCCACTGTGTTTATATGCTGTGTGTGATTCAAGGGTTCTCAAACTGGAAGGCTACGACGCGTTCAGCTTTACGATG
TTCTTCCTACGCATGCAGTTCGAGACAAACATGCATCCAGAGATCGTCCAGCTAGCCTCGATATGCATTGAAGAGCTCCTGGACGTTTTTCCGTCGGTCG
AGTGGCGCAGGGATTGGGCACCGTCGCTCGTGCTCCGCATCGCTGGGGTCAATGAAGGGCTCTTTGACTCGGCCACCGGGTGGTTGACCGTCGCGCGCCG
ACTCCCACGCACACTTCGAGGCACGCAGCTCACGACAGGGCTGGCGATCTACGTGCTGCAGCACCGTATTGACAAGTCGCCTCAGGAAGGCGTGAGTGTT
TCTATACTCGTCCAACATAACCGGAGTCGCCTCTCAAGTGCTAACTCTGTCTGTGATGATGCCTCTTGTAGTCAAACTCGGAGCGGCCACTCAAGTTTCC
AATCCAGAGCGGCCTCGTGCTAGACATTGTCGCCGGGATTGTCGAGGACCTGACGCTCAAGTACGCGGAGAAGCGGCAGAGCGGCAAGACAGCCAAGTCG
GTGCCGCCCTACGACCTGCTCTGCAAGAAAGTGGCGCTCATGGACCTGGCGCTGCAAGCGTTCCTCAACATTCTCACGCAGAAGGAGATGTCACTGCTGC
TCAAGAAGCTCGACGCGCTCACGGGCACGCACAAGTCGACCATGTCGGCCAAGTGGCACGAGGTATGAATGTTCTTGCTGAATTATTATGCATAAGAGAT
CGTCCGGTCTAATCCTGTAAATGCTGCTGTTATGATGCCTCCAGCTCAAGACGCTCGTGAGTCTCATGCACCGCAAGTACTCGCTCGAGAACCTCCGGAT
CGGCCGCGACACCTCGCCGTCTGCGAAAATGCTGCTCTTCCCAGACGAAGACGCCAAGTAGGTAGCTCCTCTTTGTGTTGTAAATGGCGTTCGACTTTAG
GAACCAGGAGACAAGAAAGCAAGACACAGGGCAGTGAGAGTGGCTTTCTTAAAGTATGGAACGTGAATTAGTCGCTCAGCTGTACCTAACTTGCTTTTAA
TCCACGTGGCTCTCTACTCCTCAGCGAGCGCGGCGAACTTCTTCTGCAGCTGCACTTCCACAAGCTGCTGCGAGTTGACCTCATTTGCGAGGCGCACGAC
GCGGCCCTGCAGAGCCACGGCCTCGAGCCCCGCGAGCCCGGCAAAGCACGAGCGCTCGATGAGCGCATTCTGGTACTCAGCCACGAGCGCGCGCAGCGAG
CCGAGCGCCTGCTCCGAGCGGCGCTGGAAACCACCGTTGATCACGCGCACGCGCTCGTCGAGCTTCTGCGCGCGCTTGGCCAGCAGCTGCTCCGTCTCCT
TGAGCTCTTCGAACTCGGCCTCGATCGCGCGGAGGCGGGCTTCCGAGGACTCGGCAAAAACGAGCTCCACGCAGTCGTTGCTCTGGTCCTTTGGCGCGAG
ACAGCGGGCTTGCGCGTCCAGCCACGCGGCCTCCAGCGTCAGCGGGCTCGCAGTCTTCCACACACTCTCCTGCGCGTGCAGACTCGCCTCGATCTGGACC
ATATTCCGC