Description :
From Genome Similarity Track
Location :
scaffold_1282:4904- 6166
Sequence
1262 bases(100 bases per row)
GAAACTTCTCCATGGCTGGAGATCGCAAGAAGCACTCGAGCCACTCTCTCCAAACCGCCCAGTTGTCCCGATCGATTCGTTCGTGACGGGCCTTAATGGT
TCGCCTTCATTTTGGCCACCGGAAGCTTTCCACCCAACTGGATCGCGGCTTCGAGTTACGATGACTCGATGTCCTTCGTCTCCTATCGCAATTTCTGTTG
AAGTTCCAAATGCGCGTGAGAGTGAGGACAACATTGCGGATCATTGCCAGCTACACGTGGACACTCAAGTAAATCTACAGCAAGGTGAATCACGAAGGCT
TCAACGTCTCTACAAACTAGAAAAGCAGGTTGCACGGGAGGAACGTATGCAAAACCAACGAGATCTAATCGAGTGGCAAAGTCGAACTCTGCATTTCAAA
CCATCGTCGGAGCTAGCAGCACATCGAAAACAACAGCAACATGACCCACAACTGCGTCACCGACGTACACAAGTTTCAGCTATTGTCCAGACGCCAGGTT
ACTCGCCTGAAAAACAGCGAATACAGGAGTCTGGCGAGCTACGAAAAAAGAGGTTCTTGCTTCGATGGCACTCGTTTGCTCGATTATTGGATGCCATGCG
ACGGACACCATGTCGACGGCCTGTGCTGCAGGATATGGAGAAACTGTTCGCTTTGGCTCGGGAATTAGGAGCCTTCAATGCCTTGGGTACCTGTATGCTC
TCTCGGGCCCAGTTCACGCAACTTGTGACGCGAGAATTCCCGCTTTGCGAACTAAAACATGTGAACCGTTTGTTCTCGTCGTACGACTGTGAACTCCGCG
ATTCCGTCGATGCTCGTGTTATTCTCGGGACCGTACGAGCGATGCGCGTGCAGCAAGGCGAGCCTGTGGAGCTAATCTGCGCATGCTTGCGCGATTTTGA
TAGCACCGGCGAAGTGAACAGCAAGAGCACAGACGACAACAAATCTGTCGTCACACATGGTATTTCAGTAGCAAAAGCATTGTCACTTTGCTGCTCCAGT
GACGAGGAAGAACGGGAGATGGAAGATAGAGCTAACATTATCTGGAGCAAGACTCTTTCTTGGCAGCGCCAGATTCTAACTCGACGACTTAACGGAGGAG
CTGGGTGCAACGTGTGGAAAACACCAGGATTTTGTAGTAGCGTCAGTAGTACTGCTCCTTCGGGAGTAGCAGATTCTGCAAGTGATGATGACATAGCAAG
CAAGCAGGAAGATGCACAGCAATTGAATGAAATAGGTGGCAACATTGACGATGAAGAGGACA