Description :
From Genome Similarity Track
Location :
Scaffold_165:49034- 56578
Transcript NameFunction/comments
Physo_144085hypothetical protein
Physo_144086PREDICTED: similar to G patch domain containing 1 isoform 1
Physo_144087PREDICTED: similar to RNA binding motif protein 34
Physo_144088hypothetical protein

Sequence
7544 bases(100 bases per row)
ATCACGTAGGGAACAACCACACGTGCAAATGGACTCGCCAGCTGGAGCACTCACTTGTCCATTTGCCGCCAGGCGGAGCAGGCACCAGATAGTGCTGCCC
GGTGTGGTCAGCATCCCGCAACCGCCAGCGCGCCTTTCGACCATCGGTTCGCCCGCGCTCATCTGCTTAAGCTGCCGGGCCTGTAACCCATGGCGCTGAG
GAAGTCTATTTCGCTGCCGATCGCACCGCCCATCAAGCTGCACCGCCGCAAGTCGGTGCAGGAGGAGCAAATGAGCCGCTCTTTCTCCTTCACCAAGCGC
CGCGTGGAGCGGCAGCCGTCGCGCCTCACGCTGACGCAGACCATGGAGCAGACGCTGCTGGACAGCGTGCACGTCGAGTTCATCAAGGCCGTGGTGCCCG
GCCAGAACAAGCTCTCGAGTCCGCGCTACGTCATGCGCATCAGCAACACGGCGCTGGACCAGACGTGGGAGATGGCACGGACGTTCAAGGAGTTCTACGA
GCTCAAGGAGGCGATCGCCAAGGTGCTGGACTACGGCCACTTCTGTCCGTCCAACTGCCCGTGGCTCTACATGTACGCCGCGCACCACTTCCCACGCCGC
CGCATCTTCCGATCGCGCAGCCCTACGGTGATCTCCGGCCGGCTATCCGAGCTGCAGACGTACTTCTCGACGCTGCTGCGCATGGCCAAGCAGAACCGCA
ACCTCGAGTGCCCCGTGTCGTCCACCAAGCTGCCGCAGCTCATCTACGACTTCCTGTTCGAGGGCATGGTCTTCGATCGCTCCGACTTCACGCGATTGAG
CGAACGCCTGTCGGTTGTCGGCCGCGATAGCAGCTTCCTGGACAACGACCCGACACAAGATCCGGACGAGTGCTTCATTTGTCGCAAGGCTCTTGTCGGC
GACGACACCGTGTCGATCGTGCCGGCCGCACCAAGCAGCAACAGGGGTGCTTCAAGCTTCAATAGCAAGGTTGACAAGCACGTGATGGCGGGTCTCACCA
CACTCGAGTGCAGCCATTGCTTCCACGACGAGTGCATCCTCGCCAAGCTCAACGAGTCGCTGCATTGCCCGCTCTGCGTCGCGCAGACCAGCCCTCCTCA
ATCCGCTGCCTAGTAAGGATATCATGTGCAGTATGTTAACGTCGCTTGGTGCAGCCAGCCACGCGTGCATGTTCATAAAATCAAATGGGAAAGGTGTATT
CAACCACCAGTGTTAACTCAACATCGCTGCATGGCTCTTCTTCTGCTGCTTTCTCGTCTACAGCAAGCTCACAAAGAGACGGCAAGTCGTGCGCAGCTTG
GGTCCTGCGGCTTGCACTGTAGCCATATCCCTTGAAATGGCTACATATTATGTGCACCACAAATCCAAAGCCCGCAATAATGAAGCGCGGCGGCGTGCGC
AACCAGGAGGTTCGTCGTGCCCTGCTGTCCCTCTTAACGCCTTAGACACCTACTCTCCGTGGCCTCCTACCTTACTGACGTGTTGTTCTTCCTGCCACCT
CCTTTCTGGCCCAAATCTCGCAGGTGACGGACGCCCAGGGCCGTCGGCGCTTCCACGGAGCCTTCACCGGAGGCTTCTCGGCTGGCTACTACAACTCTGT
GGGCAGCGAGGAAGGATGGACGCCGCGGACGTTCTCCTCGTCTCGAGGCAACCGCATGGAGCGGGTCCAGCAACGTGCGGAGGATTTCATGGACGAAGAG
GACGACCCGCTGCTCGGCAAGCGACTGGAGACCACGGAGCGCTATGATACGCTACAGACAGGGGCTAAGAGACGCCTACAGCAGCAACAACAAGCCGACC
AAGCTGCTTCTGGAGCGGGGGCAATCCCAGGCTTCGCGTTGCCTGATGACTGGGTCTTGCCGGTCAATGATTCGATTGGGGCGAAGCTGCTGAAGCAGAT
GGGCTGGAAAGAAGGCCACGGCATCGGCCAGCGTGTCCGCAGACGCAAGTTCCTGGAGGAAGAGAAGGAGGCGGTGGAGAACCTAAAGCTGTTGACCCAG
TATGCACAGGAAGAGAAGACAGAGATGAAGGCCCGAGATGGTGCTGAAGAGGAAGAGGAGGTGTGTGTGCCGCCGCGGAAGGTCTTCGACGTGCAGAAGG
CGTTCCCGAAGCCCAAGTTGGATCGATATGGCGCGGGTTTTGACCCGTACACGAATGCTCCCGAGTTTTCGAGGTATAAACAGCAGCAGGAGGAGAAGCA
GAGATCGAAGGAAGGACCTCATCGTCAGGTGGTGTCTTTCTCGGACGCTTTGACAGCTACCAACGGCAGCAATCGTGCGACTACTGGGTACGGACTAAGT
GCCTTGGAGGAAGATGACGACGTGGATGTCTACGGTACTGTCTCGATGGCGGAGTTTGATCGAGTAATCGCTCCTCTTGGGGCGAAGAAGGACTTAAAGC
GCCTGGATTCCTCAGCTCAAGAGTCTCGTCGACACGAGAAGGCGAATTCCAGAGCTTTGTGCTCGGATGGGCGACCTGTTCTTCCTGGGTTTGAGTTGGC
AGCCTCAAAGGAGAAACCCCCAAAGGCTGTAAACTTGCGCCTTGCTGTGCCTGCTGATTTTAAGGCTTATCACCATTTTAATGAAAACGTGGACGGAGAT
GAGGGTGTGACGGCACTATATCGTAAACACAACTTCTCGATCGACGCAGCCAGCAACGGTGGCATGGTCGTCACGGCAACGCAGCGCAGCGCTTTACTTG
GAGAAGATGAACTACTCAACCATGGCCACGTCGAGAAAGGTCGTGCCGATAATGCAGAGGCTTCCACCGGCAGTGTTTTCGACTTACTGGACAAGGAACA
AAGAACAAAGCTATTCAGTGCTGCTGCACAGGCAAAACAAGGGCTGCCTCTACCTAGTATAACTCGCACTGATCCAGGGGTAGAAGCACCTGCACCTCGA
GCCCGGCAGCCATTGGTCGCTGGTAGCGGTGGTGACCAATTTCGCGCCACGATTTCAGCTTCCATCGCAAAACGGTTCGTGTCCTCGACGTCTACAAATG
CTGATGAAAAGAGCGAGCTCGTGGCTACCAAGGAGCCTCAAGACAAGAATTCTCGCCGCTCACAAAGTTCGTGGATTCCTAAGTCGCTGCTTTGCAAACG
CTTTCACGTCAAATGCGAAGGGTCCATGGGGTCGAGTGGTAAAGACGGAGATGACGACAAGAAGCGAAACCTGTTTGACGAGGAGCTTGTTCCGCACTTG
ATGGAATATGCCGCTGGCCGAGCTGTTCGTGGTCAGCCCTCAGACCAGGCAGGTGCCGTCCAAAAGCCTGACGAGGATGCTAATCCTGAAAGAGAGAGCG
CACAGACGCCGCCGTTGCCAGCAGTCAAGACAGCCTCGGTCAGTTTGCTCAAATCCATCTTTGAGCCGTCGGATGAATCTGACGTGAGTGACGACGATAG
CGAAGGTGATAGTGGCGATGACGTCGATGGCGAAGAACGGAAAGAGGACAGTGTTCAGGCTTCTGTGAGCTCGGGAAGAAAAGTTTTTGAGAATGATCGC
CATTCAGCCAGCTCGGCGGAGTCCAGTTCGTCGGAAGATGAGAAGGATGACTTCTCAGTTGTTGCCGCTTCTGGTCGTGATGGTGGTGGCAAGCTGGTTG
AGCGGGGTGTGAAGCGATCGCGGAGCATTGACAGTGACGACGACCGCCATGCGAGGGAAGACAAGCGTAGGCACAAGAAACACAAAAAGCACCACCATAG
CAAACACCGCTCGTCGCGCGAGCGCAAGGATAAAAAGAGGAAAAAAGACAAGAAGGACCGCAAGGAGCGCAAGTCGCACAAGCATCGCTATTCAAAGCGC
TCTGGACGCAGTCGAAGCCCAAGCAGCAGTCGGGAGCGCAGTGCTGATCGCGACCGAAGCAGCAGCAACCGACACCGCTGACATTATTTCGCGTGAAAGA
ATAGGTGAAAACTGTAGTAGAAGTACTCAATTGTCGAGACGAATCAGGTCCCGAGCACTTCAACATTGGTCTCACTTCAACACCCACCTCGCATCAACGG
TAAATTTCGGTCCTAGAGTCTATGTAAACAGAATCGATTGAAGCTCAATGCAATGCAAAAACTAGTCAATACACGACAGAGGGATCCGTCTGCGCTGGTC
CCTCCACCGAGTCAAGCACCGTTGCCTGGCACTCTAAGCGCACGTGTCTCCCTGTCCTATGTGGAGACTGCCTCCGTCGAAGCAGCCGCCTTTAAATTAG
TCGAAAGTAACCTTGGAGCCCTTGAAGTTCTGGATGGACGACGACTGGCGCTTCGGGGGTCCGTCACCACGGCCGCCACGTCCGCCACGGCCCCCGCCGC
GACCACCGAAGCCACGGCCTCCACCGCGGCCGCCACCACGGCCACCGAAGCCACGGCCACCGCCACGGCCACCGCCACGGCCACCGTCGAAGCCGCCACG
GCCACCACGGCCACCGCGGCCACCGCCACGGCCGCCACCGCGGCCTCCGTCGAAGCCGTTGTTTTCGCGGCTCTTGGCGTAGTTGACACGGATGGCACGG
TTGTTCAAGTACTCGCCAGCGAGCTTGACAGCCTCGTCCACAGCCTCGGTCGTGGCAAAGTCAACGTGGCCGAAACCACGGAACTCGCCGGTCTCACGGT
CGGTGGCCAGGCGGCAGCTCGTGATCTCGCCGCACTCGCCGAAGAACTCGCGCACGGTGTTCTCGTCCACGTCCCAGGCGAGGTTGCCGATGAAGATGCT
GGTGCAGCCCTCCGGCTTCTCGTCGAACATGTTCTTCTTCTCGGCCGTGCGGATCTTCATCCAACGGCCACCGAAGTCCTGGCCGTCCATGGCAAGAGCA
GCCTCAGCGGCCTCGGCGGTAGCGAACGTCACGAAGGCAGTGCCAGACGAGCGGCCGTTCTGCATCGGGATGCGGGCAGCAGTCACCTCACCGCAGCCAG
CGAAGTGCTCCTTGACCTCGTCCTCCGTGGCGGACCACGGCAGGCCGGCAATGAAGATCTCCAGCGCCTTCTGCGGGTTGGCCACAGCGGCGGGCTCGCC
GTCCTCCTGCTTCTGCACCTTGTTGGACTTCTCGGCAGCGTCCGAGTTTTTACGCTTCTTGGACACAATGGGGGTCTCCTCCTCATCCGAAGACGAGTCC
GAGTCGCTGGACGACGACGACGAGTCCTCCTCCTTCTTGTCAGCAACCTTCTTGGCAGCGGGCTTCTCAGCCTCCTCGTCGTCCGAGGAGTCCGAGTCAG
ACGAAGAGCTGTCGCTCTCCTCCTTCTTGGCGGCAACCTTCTTGGCGGGGGCAGCCTTCTTGGGCTCCTCCTCCTCGTCCGAGGACGAGTCCGACGAGTC
CGAGCTCTCCTCCTTCTTAGCAGCCTCCTTCTTCACGGGGGCAGCCTTCTTGGGGGCCTCCTCTTCATCAGAAGAAGAGTCCGAGCTCGAGTCGGAGCTC
TCCTCCTTCTTGGCAGGCACCTTCTTGGTGGGGGTGGCCTTCTTCTTAGGGGCCTCTTCCTCGTCCGAGGACGAGTCCGAGCTCGAGTCGGAGCTCTCCT
CCTTCTTGGCGGCCGGCTTCTTGGCCACCACCTTCTTGGGGGCCTCCTCCTCGTCCGAACTCGAGTCCGACGACGAGCTGTCGCTGTCCACGGGCTTCTT
GGGGGCGGCCTTCTTGGCCACGACCACCTTCTTCTGCGGGGCCTCGTCGCTGCTCGAGTCCGACGAGCTGCTGCTGCTGGACGCAGGCTTCACGGGGGCT
TTCACCTTCTTGGCCATCGTTAGTCTATAGAGAGGTAGCGGGGTCTGGAGTTGCTGGGGCGCCGAGGGATTGCCAAATGACCAGCGAAGGGTGCTCCGGT
GGCTGGCTGCCAAGCCTTTTGATACCTTCAACTGTCTTGCAGAGGTTTGGTTGGCGTAGGCGCAGCTAGACCTAAAACGCGTGGACCACTCGAAAAAGGT
CGACCAAATTGTACCGTAATGGACCATACCGGGTCATGAAAGTCCCATGCGACTTTACTGTACGTCTTCGTCGACGGTGACTGACTGTGTTACCGCTCGG
TATTTACGTTTTTCGGGTCTGGACCAATTGAGGGGCCATAGAAATGTGTACACCACACGAAATGTGTGGTGCACCTGATGCCAGCCAGTTTGGCGAGGTT
TTTCTGTTCTGCGGAAAGGGGGGCGAGGTTTTATGTATCAGTTGGGTGGATTCGCACACAAGAACCACACAGTCTTTCTTTCGAATCCGCGCGCTAAATC
CTGCACTGACCCGGGCGGCAGCATGGTGGCAAGTGGCAGCGACGAGAACTCTCCGGCGGTGGACGCTGTGGCGGCCCAGGTGGTGGTGGTGGACGACGCG
ACCAAGGTGGTGCACGAGGCGGTGGTCGGAGAGAAGCGCCCGCGTGAAGAGGAGGTGGTGGACCCGCTGGTCGCGAGCGTCGAGACTGTCGTGGCCGAGG
CGCCCGGCGCTGTGGACGACACGACGGCCTCGCAGGACTCGCAGGCCACGCAGGACGAGGACATCCACGACGTCATGGCCAAGATGAAGGAGGCGGCCGG
CGCGGACGTGGCCTTCGACGCGGCGGCGGCCGCTGCGGCTGTCGTGCCACCGCCTCCCGAGGCGCTGAAGGCCGACTCGGCCACGCCCGTGCAGGACGCG
GTGGTCGCAGCTGCGGCAGCGGGCGTCGGCGCGGACCCGAACGCCGTGGCCAACGTCAAGTTCGACAGCAAGCGCATGGCGCGCGTGTCGTTCAACTCGT
GGTTCGACTTCGACTCGTACTTTGAGATGTACATGCAGGAGACGTTCCAGCCCTTCCGCATGCGCTCGTCCTGCAGCGTGGAGGCGTACCGCCGCAACCA
GCAGAAGGTCATGCTCAACAACAAGAGCTCGCGCGGACGCCGCGCCGAGTTCCCGGACGAGGCCATCCACCACCACCGGATATACATGTGCACGCACGCC
ATGAAGGCGCGTTGCCGCGGTGCCAACACGCGCCCCGGACAGAAGTACCGCGGTATCGGCTGCATGGCCAAGATCAATGTCAAGATCACTCCGGCCGATA
ACCCGTCCAAGTACATGGTGATTGTTACCGACCAGGTATGCCTTGTTGACGATCTTCCGAATCTGATTATGGATATTAACTCTTTTCGCTGTTGTTGCTG
CAGGTTGTGTCGCACAATCACCCGGTGAGCCGCGAGATCTATGAGGCGTACCCGGACGTGCTGCTCAAGATGATGCGGCGCAGCCAGCTGTCCCAGTCGA
TGCTGGGCCACCCGCCGCCGCCCAAGTTCGAGACGCCCCAGCAGACCCAGAAATACGAGCGCGCTATGAACACGTTCCAGTCCGTCGCCGAGACCATGGC
CCGGTTGAGCGACGAGGACTACGAGGCGCAGCTCGGTCAGCTCCAGCGGCTCTACACGCCCGCCACGGAGCAGGATCAAACGGTCTGAGTGTGTTAAGCC
AAAGCTGACACCAAAGGGCGGACAGGGTGGCTATATACCAGTACTCAAAGAGAAGAGGAGCTGCCGGGGGGGGCCTCGAATTCGCCCTCGTCGTGTAGCA
ACGTTCATGTCCAGCATATCATACACGTTGGATGCATTGTGGTT