Description :
From Genome Similarity Track
Location :
Scaffold_42:4903- 10884
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.3T-complex protein 1 subunit zeta
Pytir_DAOMBR486maker-pir_contig_42-snap-gene-0.45Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_42-fgenesh-gene-0.17FAD synthetase

Sequence
5981 bases(100 bases per row)
CACCATGAACCGCGGCATGAACCCGAACGCAGAGATCGTGAGCAAGTCGCAGGCGCTGCTCGTCAACGTGAGCGCCGCCAAGGGCCTTCAGGGCGTCCTG
AAGTCCAACTTGGGTGCGTTATTTTGGCTGTTTCTACATTGTTGTGCTGCTCACAGTGCAACACGATGACGATGCTGATGCGATCTTTCCCACGAGCTTC
TCGATGGTGTTGCGACTGATGATGCGTTTTATTAACGAATTGCTGGTTATGTGTATATGTGTGCGTAATGTACGTGAAGGCCCTCGTGGTACGCTCAAGA
TGCTGGTCGGCGGTGCGGGCCAGATCAAGCTCACCAAGGACGGCAACGTGCTGCTCCACGAGATGCAGATCCAGCACCCGACCGCGGCGCTGATCGCGCG
CGCCGCCACCGCGCAGGACGACATCACGGTACGCTCCGTAGCGGTGAAGAATATGCATCTGCGCTTGGTGTTCTATCGCTAACGCTACTTCATATCCCTG
TGTGTGTATAATTGAAACAGGGCGATGGCACCACGTCGACTGTGCTCTTCATCGGCGAGCTGCTGAAGCAGTCGGAGCGCTTCCTGGCCGACGGCCTGCA
CCCGCGCATCCTGTCGGAGGGCTTTGAGCTCGCGAAGGACGAGGTGCTGCGCGTGCTCGAGTCGCTCAAGGTGGTCAAGAAGGACATCCTGAAGGACCGC
GAGCTGCTCTGCTCGGTCGCGCGCACGTCGCTCCGCACCAAGCTGGACCAGAAGGTAGGCCGGCATCATGAGCCTATCATCAAGATATAGCCATATATTT
ACTGACATCTTTGTGATGTTGTGGTTACAATAGCTCGCCGACCAGTTGACGGAGATCGTCACGGACGCCGTGCTGACCATCGCGCAGCCAGGCCGCCCAG
TGGACCTGCACATGATCGAGATCATGCACATGATGCACCAGACGAGCAGCGACACGCGCCTGATCAAGGGCCTCGTGCTGGACCACGGCTCGCGCCACCC
AGACATGCCGACGTCGCTCGAGAACTGTTTCATCATGACATGCAACGTGTCGTTGGAGTACGAGAAGAGTGAGGTGAATTCGGGCTTCTTCTACAACAGC
GCCGAGCAGCGCGAGAAGATGGTCGAGGCCGAGCGCAAGTTCACGGACGACAAGGTCAAGCAGATCATCGAGCTCAAGCGTGAGGTGTGCACGGACGAGA
ACAAGAAGACGTTCGTGATCATCAACCAGAAGGGCATCGACCCGCTGTCGCTCGACATGCTCGCGAAGGAAGGCATCCTGGCGCTGCGTCGCGCCAAGCG
CCGCAACATGGAGCGCCTGACGCTCGCGTGCGGCGGCATGCCGATCAACTCGACCGAGGACATGGACGAGTCGATGCTCGGCTTTGCCGGTAAGGTGTAC
GAACAGACGCTGGGCGAAGAGCGCTACACATTTGTGGAAGATGTGGCGCACCCGCAGTCGTGCTCGATCCTGATCAAGGGCCCGAACGAGCACACGATCG
CGCAGATCAAGGACGCGATCCGCGACGGCATCCGCGCCGTGAACAACGCAATCGAGGACGAGGGCGTGATCCCGGGTGCGGCAGCGTTCGAGCTCGCGGC
CCATGAAGCGCTGAACAAATACAAGACCACGGTCAAGGGCCGCGCGAAGCTCGGCGTGCAGGCTTTCGCCGACGCGCTTCTTGTGATCCCAAAGGTGCTC
GCGGAGAACTCGGGACTCGATGTGCAGGACACGCTGATCGCGGTCCAGGAGGAGCACGCGAACTCGGGCGAGCCGGTGGGCATTGATCTCTTCACGGGCG
AGCCGATGCTGCCAGCGCAGGAGGGCATCTGGGACAACTACCGCGTGAAGCGCCAGTTCATCCACTTGGCCACGACGCTCGCATCGCAGCTGCTGCTGGT
GGATGAGGTCATGCGCGCCGGCAAGCAGATGGGTGGTGGCGGCGGCATGCAGCCAGAAGAGTAAGCACGTAGTAGGAAACACAACCGAGTTTAGTACCAA
ACACACACACACACAACAGCAGCAGTCCCCATAGTATTTTTCTATCTTACTTTCTTCCCCACATACACCTTTAACCATAAATAGCAAGCGCAAGAACAAA
CAGCAGCACTGGTAAAGCGGCAGCAACAATGCATTGAGCAACCAGCACACACAAATGGCAATGCGCGCACCGCGTAGTATGATTAACATAACTTGATTAA
CGGCTGCGCAGGAACAGCAAATAGAACACTACGATGTCGGTGACCGCGAGCAGGATAATGATAAACCACAGAAGCACCTACCCGTCCATAGCATAGTACG
TCAATAAGTGTTAGAGCCATACATAATACGCCCATACCGATGCAAATGGAAGAGTGAACGAATGGATTGTCATACCTTGCGCCGGTAGGATCGGTCGGCG
ATCTTCTGTAGCAGCGAGCGCACCTCGCCCGTAATGCTCGACGTCTCGTGCAGCATGCCTTTCATGTCCTGTAGCTGCGAGCGTTGCAGCTCCAGGTCCA
CAAGCACGTTCCGCGCCACCTCTTCCGACTCGTACATCGTCTTCTTCGACTGCTCGATTTTGTCCGACGTCCGCATCAACGCTTGCACGCTCTACAATCC
ACCACATAGAAATTCGTCAAATATCTAGCCATGCGGCAGCCATATGCACATGCATATTGCACGCATATACATCCATACATGCAAGCAGCACCGTACCTGG
TCAGACGAGAATGTGCTGTAGTTGTTCATGGTTGGATTCATGTCGGCGCCGCCAGACGCAGCGGACGTGGGGCTGCGATTCTTTAGATTCCGGCCGTTCG
CGTGGCTGTTGCTGCTGTTGCCCGTGTTGAGATGCAGATCACGGAAGCTTCCTTCCATCGCGTCTTGCTGCGTGAGAGTCAATGGAATGGCAGTGGCGTC
TTGATCGGTCTTCTCTTTCTTCTTCTTCGGATCTCGTAGCGGTCTGAGCTGCATGCAATGTTGGCATCGCTCGACCCTTCCACAAAAAAAGTTTGAATCA
GGATGTTTCCGAAAACGCTTAGAACTACTCGCATAGAAACAGTTTTTGCTATGAAATGAGTCCACAGGTTATAAAATATACAAAAGTAAGCATGTCGTCT
AGTGTCATAACGAGTCTTACAATGCGTCATAATGTGTCTCGTGCTTGGAAGCTGAGAGAAAGCGCTATCATCACACAGCAACCCTGGAAAAGCTCAACTG
GCAACAGGAAGGCAGCAAGCATGAGCTTCGGGAAGACCAACTACCGCACGGGCGGCACGCGCGGCGGCGCTGACCGTAAGGACCGCACTCAACGATAATA
GTATTGATGTGTTAGTGGTGCACTTAGTGCTAACGTATTTTTGCATGTGTGCTTGCTGCGTGTCGTGATGTGATGTGTAGAGTTCAAGTGGGACGATGTG
AAGAACGACAAGTATCGCGAGAACTACTTGGGCCACTCGGTAAATGCGCCCGTAGGCAGGTGGCAAAAAGGAAAAGACCTGACGTGGTACACGAAGACGA
GCAAGGAGCAGCGCGCGCTGGAGCTCAAGCAGGAGCTGCTGCTCGCCAAGCAGCGCGACGAAGACCTCATGAACCAAGCTCTGTACGTACATATGCACAT
TACGTCATCATTCGATCGATATTGGCTGGTGTATGCTTACGTACTCGACTTGCATTGTATAGAGGACTTGCGCCGCGCCGCCGCGAAGAGCCGACTGGGG
AGCTGGATGCGTCAGAGATCAAGGAGCTGCTGAAGCGCGGCGAGTCGGAGCGCGACGGACTGATGGCAGAGCGCGTGGAAGGGCTCGGCGCTGCGCCAGT
GGCGTCGTCCGGAGTGGACGCGGGTCCGAAGAAGACGCTTGCAGAGCGATACAAAGAGACGCTGGAGTCTGGCAAGCAAGACACGACGTTTGCGCTCCCA
GGCACGATTTCATCGAGCGCGGACGCTTCTGGTGGTGGCGATTCTCGGAGCGAAACGAAAGAAGAGAGAAAGATCCGGAAAGCGGCCAAGAAGCTCAAGC
GTAAAGAAGAAAAGAAGGTGAAGAAAGAGCGCAAGCGAGAGCGGAGGGAGAAGAAGAAGTCCTCTTCGTCAGCGTTGCATCGTTACAAGCATGAGAGTGA
TAGCAGCGGCAGTGAAGAGGATAAAGATGATGGCGTAAAACGTGGTCGCTCTCCAGATTCCCGCTCGCGATCTCGTTCACCAGTCCACCGTAGAGATCGA
CCACGCGATTCGTTTCGCTCACCGCCAAGAGATCGCAAAATTTCGCGTCCACGATCACGCTCAGCGTCCAGAGAGCAGGGTAAAGGACGCGCGACGGATA
GAGGAAGAGATCATCATGACGCTGTGCGACGCGACCGCACGAGTCGCTCCCGATCGCGCTCACTGTCTCCACCACGTGCTGCTGAGTCCGGTCGACACCG
CTACCGTTCAAGATCGTGTTCACACTCGCCTCGAAGAAGTGACAGCAGATATCGGAGACGCGAGGCGTCGAGATCTAGATCGCGATTCAATCGGCGCCGC
TGAAAGTTCCAAACAAAGGCAGCTAGCTACAAACTAGGGATGCCGGGATCAAATGGAATTGTTCTTTTGGATAAGAGCGTAATTGACTCCATGGATCTGT
GCTTTGGCATTGAAAATCTATGATATTGCATAAAGAAAGCTGAGGCTATGTGTCCTTTTCACTATTTCGTTCACCCATGTCCGTTGTTTTGAATTCTCTC
CTGTCTGTCGTCTATGTATATCTTGTGCAGTCAATGAATTCCTTTTCGCATCCAGTCCTAGTCGGATTTGGAGGACGTGTGCGCTTTCTTCTGTCGCCCG
CAGCGCTCCGAGTTGCCGTCCTTGAGCTCGTACGCGGGCAGGTAGAACCCACCCTCGCTGCCGTCCTCGCCCTCTTTCTGCCACAGCGCCGGGTTCTGCA
CCGTGTCGTAGATGTTGCCCAGCGACGTGTATCTACACCAATCGAGAGCTCTGGTTAATCCATTCGCTAGAGATAAATAAACAAAAATATGAGCACCATA
CTGCCTACACAAACGCTTACCCGTGGTCGTACAGGTGGCAGTACTCGAGCTTGCACTCGCGCAGAAAGTCCCACACGTCCGCGTACGTCCAGCGCAGGAT
CGGGTTCACGCGCAGGAACGCAGGCCACCCGGGGGTGCTTGGAGAGTAATGCTCCAAGTCCTCTGTGTGTGGGTCGCCGCCGCGAACGCCCATGTAGATG
CCCTTGATGTGCAGTTTCTCGAGGATGTCCTTGACACCTTCGACAAACGAGCACTTGTACACGTGACAGCTCAGCGAGAACTTCTCGACACACATTTCGA
TGAAATTGCGCACTTCGGGGAACTGATCGTGCGAGTCAAAGTACATCACCGGCACGCGCTTCATCAGCTGATGCACGCGCGCTTCGAGCTCGTCTTCGCT
CAGCAGGTCCGTGCTCACGAAGCTCTGGCGCGGCGACGTGACGGTCTTCGAAGCTCGCGTCGTCGCCGCCNNNNNNNNNNNNNNNNNNNNNNGCTTCTTT
CGCGAGTCGCTCTTCTTCGCGGCGCTTCATCTCCGCGAGTTGCGTCTGCTCAAGCACACGCTTCGCGATCACGATGCGTAGCAGGTACAGCACGACGGTC
GAGTCCTTGCCACCGTTGAAGCTGAAGCAGACGCCCTCGAGGTCGAAGATGTCGATCGCGCGATGGATCACGTCCAGCGCCTTCTGCAGCCGCGCGCGTG
TGGGCACGTCTACCGCCGCGTAGAACGCGTCGAAGCGCTGGATCGTCTCTCGGATGCCCGTGTGAACCACCATTGTTGTATCTATCGTTCTGCCCTGAAA
AAGCGTAATGCGCGCGCGTCTCTATCTGCTTCTGGTAATGCTCGCTCGCTTTTCTGGCTTCTTTCGGCTGATCTTTATTAGTGAGGAGCACTTCCAGCGG
ACTGAAATGCGCACGTCAACTCAGGAGAGCGTGCCTCTATGATTGGCTGATTGTATAATATGTCTTGATATTCAGCCAACG